ID: 1007932264

View in Genome Browser
Species Human (GRCh38)
Location 6:45702314-45702336
Sequence CTGTCCGCCTTGAGTGATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007932262_1007932264 -7 Left 1007932262 6:45702298-45702320 CCACGTAACTGCAGTGCTGTCCG No data
Right 1007932264 6:45702314-45702336 CTGTCCGCCTTGAGTGATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007932264 Original CRISPR CTGTCCGCCTTGAGTGATCA GGG Intergenic
No off target data available for this crispr