ID: 1007935236

View in Genome Browser
Species Human (GRCh38)
Location 6:45726892-45726914
Sequence ACTGCCTTCTGCGCTGTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007935228_1007935236 13 Left 1007935228 6:45726856-45726878 CCTTTAAGTAGGCACCATGGAGG No data
Right 1007935236 6:45726892-45726914 ACTGCCTTCTGCGCTGTTCCTGG No data
1007935226_1007935236 23 Left 1007935226 6:45726846-45726868 CCATTAGAGTCCTTTAAGTAGGC No data
Right 1007935236 6:45726892-45726914 ACTGCCTTCTGCGCTGTTCCTGG No data
1007935234_1007935236 -1 Left 1007935234 6:45726870-45726892 CCATGGAGGTGGGGGTCACCACA No data
Right 1007935236 6:45726892-45726914 ACTGCCTTCTGCGCTGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007935236 Original CRISPR ACTGCCTTCTGCGCTGTTCC TGG Intergenic
No off target data available for this crispr