ID: 1007940867

View in Genome Browser
Species Human (GRCh38)
Location 6:45780213-45780235
Sequence CCTCATCTGCAAAAGGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007940867_1007940874 22 Left 1007940867 6:45780213-45780235 CCCCTCTCCTTTTGCAGATGAGG No data
Right 1007940874 6:45780258-45780280 AATAGCATGCTCACAGTTCTGGG No data
1007940867_1007940873 21 Left 1007940867 6:45780213-45780235 CCCCTCTCCTTTTGCAGATGAGG No data
Right 1007940873 6:45780257-45780279 AAATAGCATGCTCACAGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007940867 Original CRISPR CCTCATCTGCAAAAGGAGAG GGG (reversed) Intergenic
No off target data available for this crispr