ID: 1007940874

View in Genome Browser
Species Human (GRCh38)
Location 6:45780258-45780280
Sequence AATAGCATGCTCACAGTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007940872_1007940874 -10 Left 1007940872 6:45780245-45780267 CCTAAAGTAATTAAATAGCATGC No data
Right 1007940874 6:45780258-45780280 AATAGCATGCTCACAGTTCTGGG No data
1007940867_1007940874 22 Left 1007940867 6:45780213-45780235 CCCCTCTCCTTTTGCAGATGAGG No data
Right 1007940874 6:45780258-45780280 AATAGCATGCTCACAGTTCTGGG No data
1007940871_1007940874 15 Left 1007940871 6:45780220-45780242 CCTTTTGCAGATGAGGAAACTGA 0: 14
1: 237
2: 785
3: 1765
4: 3393
Right 1007940874 6:45780258-45780280 AATAGCATGCTCACAGTTCTGGG No data
1007940870_1007940874 20 Left 1007940870 6:45780215-45780237 CCTCTCCTTTTGCAGATGAGGAA No data
Right 1007940874 6:45780258-45780280 AATAGCATGCTCACAGTTCTGGG No data
1007940869_1007940874 21 Left 1007940869 6:45780214-45780236 CCCTCTCCTTTTGCAGATGAGGA No data
Right 1007940874 6:45780258-45780280 AATAGCATGCTCACAGTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007940874 Original CRISPR AATAGCATGCTCACAGTTCT GGG Intergenic
No off target data available for this crispr