ID: 1007943247

View in Genome Browser
Species Human (GRCh38)
Location 6:45801815-45801837
Sequence AGAAAGCTTCTGGCCAAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007943244_1007943247 7 Left 1007943244 6:45801785-45801807 CCTGGGGGAGAAAGGTTATGAGG No data
Right 1007943247 6:45801815-45801837 AGAAAGCTTCTGGCCAAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007943247 Original CRISPR AGAAAGCTTCTGGCCAAATT TGG Intergenic
No off target data available for this crispr