ID: 1007951495

View in Genome Browser
Species Human (GRCh38)
Location 6:45876556-45876578
Sequence TGTGAGATAATGCATCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007951490_1007951495 17 Left 1007951490 6:45876516-45876538 CCTCCTTTTTTTCTCTCTCTCTC No data
Right 1007951495 6:45876556-45876578 TGTGAGATAATGCATCAAGAAGG No data
1007951489_1007951495 18 Left 1007951489 6:45876515-45876537 CCCTCCTTTTTTTCTCTCTCTCT No data
Right 1007951495 6:45876556-45876578 TGTGAGATAATGCATCAAGAAGG No data
1007951492_1007951495 -7 Left 1007951492 6:45876540-45876562 CCCTCTTGCCTTTCGCTGTGAGA No data
Right 1007951495 6:45876556-45876578 TGTGAGATAATGCATCAAGAAGG No data
1007951488_1007951495 19 Left 1007951488 6:45876514-45876536 CCCCTCCTTTTTTTCTCTCTCTC 0: 3
1: 16
2: 145
3: 1074
4: 5840
Right 1007951495 6:45876556-45876578 TGTGAGATAATGCATCAAGAAGG No data
1007951493_1007951495 -8 Left 1007951493 6:45876541-45876563 CCTCTTGCCTTTCGCTGTGAGAT No data
Right 1007951495 6:45876556-45876578 TGTGAGATAATGCATCAAGAAGG No data
1007951487_1007951495 20 Left 1007951487 6:45876513-45876535 CCCCCTCCTTTTTTTCTCTCTCT No data
Right 1007951495 6:45876556-45876578 TGTGAGATAATGCATCAAGAAGG No data
1007951491_1007951495 14 Left 1007951491 6:45876519-45876541 CCTTTTTTTCTCTCTCTCTCACC No data
Right 1007951495 6:45876556-45876578 TGTGAGATAATGCATCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007951495 Original CRISPR TGTGAGATAATGCATCAAGA AGG Intergenic
No off target data available for this crispr