ID: 1007951740

View in Genome Browser
Species Human (GRCh38)
Location 6:45878656-45878678
Sequence TGTGCTTCTGCTCCAGGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007951740_1007951743 -2 Left 1007951740 6:45878656-45878678 CCAGAACCTGGAGCAGAAGCACA No data
Right 1007951743 6:45878677-45878699 CACCAAAGTAGAAAGAGCTAGGG No data
1007951740_1007951746 17 Left 1007951740 6:45878656-45878678 CCAGAACCTGGAGCAGAAGCACA No data
Right 1007951746 6:45878696-45878718 AGGGGTGCCAAAGAGTGCCCAGG No data
1007951740_1007951744 -1 Left 1007951740 6:45878656-45878678 CCAGAACCTGGAGCAGAAGCACA No data
Right 1007951744 6:45878678-45878700 ACCAAAGTAGAAAGAGCTAGGGG No data
1007951740_1007951747 22 Left 1007951740 6:45878656-45878678 CCAGAACCTGGAGCAGAAGCACA No data
Right 1007951747 6:45878701-45878723 TGCCAAAGAGTGCCCAGGCCTGG No data
1007951740_1007951742 -3 Left 1007951740 6:45878656-45878678 CCAGAACCTGGAGCAGAAGCACA No data
Right 1007951742 6:45878676-45878698 ACACCAAAGTAGAAAGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007951740 Original CRISPR TGTGCTTCTGCTCCAGGTTC TGG (reversed) Intergenic