ID: 1007951741

View in Genome Browser
Species Human (GRCh38)
Location 6:45878662-45878684
Sequence CTTTGGTGTGCTTCTGCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007951741_1007951744 -7 Left 1007951741 6:45878662-45878684 CCTGGAGCAGAAGCACACCAAAG No data
Right 1007951744 6:45878678-45878700 ACCAAAGTAGAAAGAGCTAGGGG No data
1007951741_1007951747 16 Left 1007951741 6:45878662-45878684 CCTGGAGCAGAAGCACACCAAAG No data
Right 1007951747 6:45878701-45878723 TGCCAAAGAGTGCCCAGGCCTGG No data
1007951741_1007951746 11 Left 1007951741 6:45878662-45878684 CCTGGAGCAGAAGCACACCAAAG No data
Right 1007951746 6:45878696-45878718 AGGGGTGCCAAAGAGTGCCCAGG No data
1007951741_1007951743 -8 Left 1007951741 6:45878662-45878684 CCTGGAGCAGAAGCACACCAAAG No data
Right 1007951743 6:45878677-45878699 CACCAAAGTAGAAAGAGCTAGGG No data
1007951741_1007951742 -9 Left 1007951741 6:45878662-45878684 CCTGGAGCAGAAGCACACCAAAG No data
Right 1007951742 6:45878676-45878698 ACACCAAAGTAGAAAGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007951741 Original CRISPR CTTTGGTGTGCTTCTGCTCC AGG (reversed) Intergenic
No off target data available for this crispr