ID: 1007951744

View in Genome Browser
Species Human (GRCh38)
Location 6:45878678-45878700
Sequence ACCAAAGTAGAAAGAGCTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007951741_1007951744 -7 Left 1007951741 6:45878662-45878684 CCTGGAGCAGAAGCACACCAAAG No data
Right 1007951744 6:45878678-45878700 ACCAAAGTAGAAAGAGCTAGGGG No data
1007951740_1007951744 -1 Left 1007951740 6:45878656-45878678 CCAGAACCTGGAGCAGAAGCACA No data
Right 1007951744 6:45878678-45878700 ACCAAAGTAGAAAGAGCTAGGGG No data
1007951739_1007951744 5 Left 1007951739 6:45878650-45878672 CCAGAACCAGAACCTGGAGCAGA No data
Right 1007951744 6:45878678-45878700 ACCAAAGTAGAAAGAGCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007951744 Original CRISPR ACCAAAGTAGAAAGAGCTAG GGG Intergenic
No off target data available for this crispr