ID: 1007951745

View in Genome Browser
Species Human (GRCh38)
Location 6:45878679-45878701
Sequence ACCCCTAGCTCTTTCTACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007951745_1007951747 -1 Left 1007951745 6:45878679-45878701 CCAAAGTAGAAAGAGCTAGGGGT No data
Right 1007951747 6:45878701-45878723 TGCCAAAGAGTGCCCAGGCCTGG No data
1007951745_1007951753 26 Left 1007951745 6:45878679-45878701 CCAAAGTAGAAAGAGCTAGGGGT No data
Right 1007951753 6:45878728-45878750 TGATTTCTTTAGAAAAGAGAGGG No data
1007951745_1007951752 25 Left 1007951745 6:45878679-45878701 CCAAAGTAGAAAGAGCTAGGGGT No data
Right 1007951752 6:45878727-45878749 CTGATTTCTTTAGAAAAGAGAGG No data
1007951745_1007951746 -6 Left 1007951745 6:45878679-45878701 CCAAAGTAGAAAGAGCTAGGGGT No data
Right 1007951746 6:45878696-45878718 AGGGGTGCCAAAGAGTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007951745 Original CRISPR ACCCCTAGCTCTTTCTACTT TGG (reversed) Intergenic