ID: 1007951747

View in Genome Browser
Species Human (GRCh38)
Location 6:45878701-45878723
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007951740_1007951747 22 Left 1007951740 6:45878656-45878678 CCAGAACCTGGAGCAGAAGCACA No data
Right 1007951747 6:45878701-45878723 TGCCAAAGAGTGCCCAGGCCTGG No data
1007951739_1007951747 28 Left 1007951739 6:45878650-45878672 CCAGAACCAGAACCTGGAGCAGA No data
Right 1007951747 6:45878701-45878723 TGCCAAAGAGTGCCCAGGCCTGG No data
1007951741_1007951747 16 Left 1007951741 6:45878662-45878684 CCTGGAGCAGAAGCACACCAAAG No data
Right 1007951747 6:45878701-45878723 TGCCAAAGAGTGCCCAGGCCTGG No data
1007951745_1007951747 -1 Left 1007951745 6:45878679-45878701 CCAAAGTAGAAAGAGCTAGGGGT No data
Right 1007951747 6:45878701-45878723 TGCCAAAGAGTGCCCAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007951747 Original CRISPR TGCCAAAGAGTGCCCAGGCC TGG Intergenic