ID: 1007952020

View in Genome Browser
Species Human (GRCh38)
Location 6:45880955-45880977
Sequence TAATTTTACTAGAGGGAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007952015_1007952020 22 Left 1007952015 6:45880910-45880932 CCGGTGACATTTCAAGAGCTAGA No data
Right 1007952020 6:45880955-45880977 TAATTTTACTAGAGGGAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007952020 Original CRISPR TAATTTTACTAGAGGGAATG GGG Intergenic
No off target data available for this crispr