ID: 1007952020 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:45880955-45880977 |
| Sequence | TAATTTTACTAGAGGGAATG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1007952015_1007952020 | 22 | Left | 1007952015 | 6:45880910-45880932 | CCGGTGACATTTCAAGAGCTAGA | No data | ||
| Right | 1007952020 | 6:45880955-45880977 | TAATTTTACTAGAGGGAATGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1007952020 | Original CRISPR | TAATTTTACTAGAGGGAATG GGG | Intergenic | ||
| No off target data available for this crispr | |||||