ID: 1007952122

View in Genome Browser
Species Human (GRCh38)
Location 6:45881807-45881829
Sequence ACAACCTTCTGCACTTGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007952122_1007952130 19 Left 1007952122 6:45881807-45881829 CCTCTTCAAGTGCAGAAGGTTGT No data
Right 1007952130 6:45881849-45881871 AACCTGACCACCAAGGGCATGGG No data
1007952122_1007952129 18 Left 1007952122 6:45881807-45881829 CCTCTTCAAGTGCAGAAGGTTGT No data
Right 1007952129 6:45881848-45881870 CAACCTGACCACCAAGGGCATGG No data
1007952122_1007952124 -10 Left 1007952122 6:45881807-45881829 CCTCTTCAAGTGCAGAAGGTTGT No data
Right 1007952124 6:45881820-45881842 AGAAGGTTGTGTTTGGCCAAAGG No data
1007952122_1007952126 12 Left 1007952122 6:45881807-45881829 CCTCTTCAAGTGCAGAAGGTTGT No data
Right 1007952126 6:45881842-45881864 GAAAACCAACCTGACCACCAAGG No data
1007952122_1007952132 24 Left 1007952122 6:45881807-45881829 CCTCTTCAAGTGCAGAAGGTTGT No data
Right 1007952132 6:45881854-45881876 GACCACCAAGGGCATGGGTCTGG No data
1007952122_1007952127 13 Left 1007952122 6:45881807-45881829 CCTCTTCAAGTGCAGAAGGTTGT No data
Right 1007952127 6:45881843-45881865 AAAACCAACCTGACCACCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007952122 Original CRISPR ACAACCTTCTGCACTTGAAG AGG (reversed) Intergenic