ID: 1007952126

View in Genome Browser
Species Human (GRCh38)
Location 6:45881842-45881864
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007952115_1007952126 30 Left 1007952115 6:45881789-45881811 CCTTCCACCCCAGGCTGCCCTCT No data
Right 1007952126 6:45881842-45881864 GAAAACCAACCTGACCACCAAGG No data
1007952117_1007952126 23 Left 1007952117 6:45881796-45881818 CCCCAGGCTGCCCTCTTCAAGTG No data
Right 1007952126 6:45881842-45881864 GAAAACCAACCTGACCACCAAGG No data
1007952122_1007952126 12 Left 1007952122 6:45881807-45881829 CCTCTTCAAGTGCAGAAGGTTGT No data
Right 1007952126 6:45881842-45881864 GAAAACCAACCTGACCACCAAGG No data
1007952119_1007952126 21 Left 1007952119 6:45881798-45881820 CCAGGCTGCCCTCTTCAAGTGCA No data
Right 1007952126 6:45881842-45881864 GAAAACCAACCTGACCACCAAGG No data
1007952116_1007952126 26 Left 1007952116 6:45881793-45881815 CCACCCCAGGCTGCCCTCTTCAA No data
Right 1007952126 6:45881842-45881864 GAAAACCAACCTGACCACCAAGG No data
1007952121_1007952126 13 Left 1007952121 6:45881806-45881828 CCCTCTTCAAGTGCAGAAGGTTG No data
Right 1007952126 6:45881842-45881864 GAAAACCAACCTGACCACCAAGG No data
1007952118_1007952126 22 Left 1007952118 6:45881797-45881819 CCCAGGCTGCCCTCTTCAAGTGC No data
Right 1007952126 6:45881842-45881864 GAAAACCAACCTGACCACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007952126 Original CRISPR GAAAACCAACCTGACCACCA AGG Intergenic