ID: 1007952130

View in Genome Browser
Species Human (GRCh38)
Location 6:45881849-45881871
Sequence AACCTGACCACCAAGGGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007952118_1007952130 29 Left 1007952118 6:45881797-45881819 CCCAGGCTGCCCTCTTCAAGTGC No data
Right 1007952130 6:45881849-45881871 AACCTGACCACCAAGGGCATGGG No data
1007952125_1007952130 -10 Left 1007952125 6:45881836-45881858 CCAAAGGAAAACCAACCTGACCA No data
Right 1007952130 6:45881849-45881871 AACCTGACCACCAAGGGCATGGG No data
1007952119_1007952130 28 Left 1007952119 6:45881798-45881820 CCAGGCTGCCCTCTTCAAGTGCA No data
Right 1007952130 6:45881849-45881871 AACCTGACCACCAAGGGCATGGG No data
1007952122_1007952130 19 Left 1007952122 6:45881807-45881829 CCTCTTCAAGTGCAGAAGGTTGT No data
Right 1007952130 6:45881849-45881871 AACCTGACCACCAAGGGCATGGG No data
1007952117_1007952130 30 Left 1007952117 6:45881796-45881818 CCCCAGGCTGCCCTCTTCAAGTG No data
Right 1007952130 6:45881849-45881871 AACCTGACCACCAAGGGCATGGG No data
1007952121_1007952130 20 Left 1007952121 6:45881806-45881828 CCCTCTTCAAGTGCAGAAGGTTG No data
Right 1007952130 6:45881849-45881871 AACCTGACCACCAAGGGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007952130 Original CRISPR AACCTGACCACCAAGGGCAT GGG Intergenic