ID: 1007952132

View in Genome Browser
Species Human (GRCh38)
Location 6:45881854-45881876
Sequence GACCACCAAGGGCATGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007952122_1007952132 24 Left 1007952122 6:45881807-45881829 CCTCTTCAAGTGCAGAAGGTTGT No data
Right 1007952132 6:45881854-45881876 GACCACCAAGGGCATGGGTCTGG No data
1007952121_1007952132 25 Left 1007952121 6:45881806-45881828 CCCTCTTCAAGTGCAGAAGGTTG No data
Right 1007952132 6:45881854-45881876 GACCACCAAGGGCATGGGTCTGG No data
1007952125_1007952132 -5 Left 1007952125 6:45881836-45881858 CCAAAGGAAAACCAACCTGACCA No data
Right 1007952132 6:45881854-45881876 GACCACCAAGGGCATGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007952132 Original CRISPR GACCACCAAGGGCATGGGTC TGG Intergenic