ID: 1007952206

View in Genome Browser
Species Human (GRCh38)
Location 6:45882400-45882422
Sequence CTTGAGGTTTTCAAGGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007952206_1007952213 0 Left 1007952206 6:45882400-45882422 CCACCACCCTTGAAAACCTCAAG No data
Right 1007952213 6:45882423-45882445 GCACTCACAACTGTGGCCCTTGG No data
1007952206_1007952212 -7 Left 1007952206 6:45882400-45882422 CCACCACCCTTGAAAACCTCAAG No data
Right 1007952212 6:45882416-45882438 CCTCAAGGCACTCACAACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007952206 Original CRISPR CTTGAGGTTTTCAAGGGTGG TGG (reversed) Intergenic
No off target data available for this crispr