ID: 1007954279

View in Genome Browser
Species Human (GRCh38)
Location 6:45902195-45902217
Sequence TTGAGCTATGAGAAAGTGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 237}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007954279_1007954283 11 Left 1007954279 6:45902195-45902217 CCATCCACTTTCTCATAGCTCAA 0: 1
1: 0
2: 0
3: 15
4: 237
Right 1007954283 6:45902229-45902251 TGGTAAGCACAGTCAAACCCAGG 0: 1
1: 0
2: 1
3: 8
4: 154
1007954279_1007954281 -9 Left 1007954279 6:45902195-45902217 CCATCCACTTTCTCATAGCTCAA 0: 1
1: 0
2: 0
3: 15
4: 237
Right 1007954281 6:45902209-45902231 ATAGCTCAAAAACCACTCATTGG 0: 1
1: 0
2: 1
3: 18
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007954279 Original CRISPR TTGAGCTATGAGAAAGTGGA TGG (reversed) Exonic
900825342 1:4921655-4921677 TTGAGATATGTGAGTGTGGATGG - Intergenic
900846395 1:5105715-5105737 ATGACCAGTGAGAAAGTGGAAGG + Intergenic
901353038 1:8615173-8615195 TTGAACTTTGAGAAAATGGCAGG - Intronic
903449208 1:23441469-23441491 TGGAGCTATGGGACAGAGGATGG + Exonic
904464962 1:30702159-30702181 ATGAGTGATGGGAAAGTGGAGGG - Intergenic
904983301 1:34524570-34524592 TTGAGATATGGGAAAGTGAGGGG - Intergenic
910667394 1:89739832-89739854 TTGATCTGTGAGAAAGGGGCAGG + Intronic
911658461 1:100473001-100473023 TTAAACAAGGAGAAAGTGGAAGG - Intronic
913314165 1:117536088-117536110 TTGAGCAATGAGAAATTTGTAGG + Intergenic
913504556 1:119504592-119504614 TTGAGCTGTGAGTAAGAGTAAGG + Intergenic
913558840 1:119997630-119997652 GTGAGCTCTGAGAGAGTAGATGG - Intronic
913639014 1:120792841-120792863 GTGAGCTCTGAGAGAGTAGATGG + Intergenic
914279443 1:146157113-146157135 GTGAGCTCTGAGAGAGTAGATGG - Intronic
914540484 1:148608043-148608065 GTGAGCTCTGAGAGAGTAGATGG - Intronic
915168051 1:153959486-153959508 CTGTGCTTTGAGAAAGAGGAAGG + Exonic
915476200 1:156154198-156154220 TTGGGCTATGAGAAGAGGGAAGG + Intronic
915826555 1:159084339-159084361 TTGAGCTGTGTGAAAGGAGAAGG - Intronic
915884989 1:159712921-159712943 GTGTGCTTTGAGAAAGTGGAGGG + Exonic
916184640 1:162118957-162118979 TAGACCTATGAGAAAGTTCATGG + Intronic
916523204 1:165584400-165584422 AAGAGCTATGAGTAACTGGAGGG - Intergenic
920656904 1:207883885-207883907 TTGAGGGATAAGAAAGTAGAAGG - Intergenic
920938534 1:210458630-210458652 GTGAGCAAAGAGAAAGTGAAGGG + Intronic
921153704 1:212421751-212421773 TCCAGCTATGAGGATGTGGAGGG - Intergenic
924447554 1:244148004-244148026 TTGACCTGTGAAAGAGTGGAAGG + Intergenic
1067004903 10:42651466-42651488 TTCACCTATGAGATAGTGCATGG + Intergenic
1067285745 10:44906518-44906540 TTGAGGGATGAGGTAGTGGAGGG + Intergenic
1067315746 10:45160402-45160424 TTGAGCCATGATAATGTTGATGG + Intergenic
1067784137 10:49230128-49230150 TTGAGCCAGGAGAATGGGGAGGG + Intergenic
1069545770 10:69327340-69327362 TTGAGCTAAAAGAAAGTAAATGG - Intronic
1070391775 10:75977239-75977261 TTGAGCTATGAGTAAATTGCTGG - Intronic
1073675880 10:105646685-105646707 TTAAGCTATGGGCAAGGGGAAGG - Intergenic
1076030137 10:127150336-127150358 CTGAGCAAAGAGAAAGGGGAGGG - Intronic
1076223198 10:128751420-128751442 GTGAGCTATGCAGAAGTGGAGGG + Intergenic
1077797415 11:5507255-5507277 GTGGGCTATGAGAAAAAGGATGG - Intronic
1079586456 11:22130876-22130898 TTGAGCTATGATCCAGTAGATGG - Intergenic
1079837132 11:25349682-25349704 TTGAGCTATGATCCAGTAGATGG + Intergenic
1080189487 11:29526889-29526911 TTGAGCTAGGAGGTAGTTGATGG - Intergenic
1082890907 11:58137642-58137664 ATGAGCCATGAGACAGTGGCTGG + Intronic
1086745107 11:90415780-90415802 TTAGGCTGTGAGAAAGTGAAGGG - Intergenic
1087264692 11:96047279-96047301 TTGAGCAACAAGAAAGTGAAAGG - Intronic
1087903930 11:103673836-103673858 CTGAGGTTTGAGAAAGTGCACGG - Intergenic
1088880003 11:113965681-113965703 TTGATCTTTGAGGAAGTTGATGG + Intergenic
1089797275 11:120991439-120991461 TTGTGCTATGAGTAACAGGATGG - Intergenic
1089995873 11:122906869-122906891 TTGAACTTGGAGAAAGTGGTGGG - Intronic
1091229182 11:133976871-133976893 GTAAGTTATGTGAAAGTGGAAGG + Intergenic
1091776583 12:3188694-3188716 TGGAGCTCTGAGAATGTGGCTGG - Intronic
1093674296 12:21917644-21917666 TTGTGCTATGTGAAAGTGCGTGG - Intronic
1098229381 12:68357507-68357529 ATAGGGTATGAGAAAGTGGAAGG - Intergenic
1099384783 12:82001077-82001099 TTGAGATTTGACAAAGTGAAAGG + Intergenic
1099932304 12:89088392-89088414 GTGAGATGAGAGAAAGTGGAGGG + Intergenic
1100183617 12:92112645-92112667 ATGAAATATGAGAAAGTGGCTGG - Intronic
1100708557 12:97228693-97228715 AAGAGTTATGAGAAAGGGGAAGG - Intergenic
1100755655 12:97748566-97748588 ATGATTTATGAGAAAGTAGATGG + Intergenic
1101605561 12:106246052-106246074 TTGAGCAATGACATAGTGGAGGG + Intronic
1103430361 12:120879550-120879572 ATGAGCTATGAGAAGTTGGGCGG - Intronic
1104549227 12:129740863-129740885 TTGAGATAACAGAAAGTGGCCGG - Intronic
1105333387 13:19439276-19439298 TTGACCTATGAGCCAGTAGATGG - Intronic
1105831148 13:24163867-24163889 TTGAGCTAAGAGGCATTGGAAGG + Intronic
1107597397 13:41977095-41977117 TAAAGCTATGAGAAAGTTTAAGG - Intergenic
1108039747 13:46329050-46329072 ATGAGCTGTGAGAAAGTTCAAGG + Intergenic
1108505491 13:51108920-51108942 TTGAGCTATCTGAAGATGGAGGG - Intergenic
1109071788 13:57778823-57778845 TTGAGGTATGTGAAAGTGCCTGG + Intergenic
1109465336 13:62724890-62724912 TGGATCTAGGAGAAAGTAGAAGG - Intergenic
1111456143 13:88486831-88486853 TTGAGTTAGAAGAAATTGGAGGG - Intergenic
1111689636 13:91546975-91546997 TTTAGCAATGAGAAGGTAGATGG + Intronic
1115762083 14:36584655-36584677 TTGAACTATGAGATTGTGTAAGG + Intergenic
1118435721 14:65769492-65769514 GTAACCAATGAGAAAGTGGATGG + Intergenic
1118542881 14:66849862-66849884 TTGAGAAATGAGAAAATGAATGG - Intronic
1119568105 14:75646047-75646069 TTCAGCTGTCAGAATGTGGAGGG + Intronic
1119770707 14:77219203-77219225 CTCAGCAATGAGAAAGAGGAAGG - Intronic
1122419551 14:101566852-101566874 TTGAGCAAGGAGAGAGAGGAGGG + Intergenic
1202927585 14_KI270725v1_random:4467-4489 TTATGGTATGAGGAAGTGGAGGG - Intergenic
1123722412 15:23071142-23071164 ATGACCTATGAGTAAATGGAAGG - Intergenic
1125072168 15:35567931-35567953 TTAACCTATGAGAAAGTGAATGG + Intergenic
1125487730 15:40123957-40123979 GTGAGCTATGAGACCGTGGCCGG + Intergenic
1127337527 15:58004091-58004113 TTGAGCAATGAAAAAGTGGGTGG - Intronic
1128363456 15:66979568-66979590 GGGGGCTATGAGAAAGGGGAGGG - Intergenic
1128936607 15:71751130-71751152 TTTAGCCTGGAGAAAGTGGAAGG - Intronic
1130424969 15:83787826-83787848 TTGAGAAAGGAGAAAGAGGAGGG - Intronic
1131439286 15:92446872-92446894 GTGAGCAAGGAGAAAGGGGAAGG + Intronic
1131692438 15:94841735-94841757 GTGAGCAATGAGCAAGTGGAAGG - Intergenic
1131735520 15:95327177-95327199 ACGCGCTATGGGAAAGTGGAGGG + Intergenic
1132054494 15:98639072-98639094 TTGAACAATGAGTAAATGGATGG + Intergenic
1132799741 16:1746134-1746156 TTGAGGTGTGGGAAAGTGCAAGG - Intronic
1133144682 16:3775874-3775896 TTGAGCCTTGGGAAAGTGGCTGG - Intronic
1134805463 16:17120393-17120415 TGGAGCAAGGAGCAAGTGGAAGG - Intronic
1136294713 16:29295043-29295065 CTGGGCTGTGAGAAAGGGGAGGG - Intergenic
1137380081 16:47990018-47990040 ATGAGATATGAGAAAGTGGGTGG + Intergenic
1139530557 16:67540497-67540519 ATGAGGTATGAGAATGTGCAGGG + Exonic
1140142706 16:72273737-72273759 ATGAGCTCTTAAAAAGTGGATGG - Intergenic
1140590847 16:76350907-76350929 TTAAGGTAGGAGAAAGAGGACGG + Intronic
1141159952 16:81622576-81622598 CTGAGCTAAGAGAAAATGCAAGG - Intronic
1141294865 16:82758214-82758236 TTGAGCTATGAGAAAAAAAAGGG + Intronic
1142100616 16:88269087-88269109 CTGGGCTGTGAGAAAGGGGAGGG - Intergenic
1143477014 17:7208583-7208605 TAGAGCTCTGAGAAGCTGGAGGG - Intronic
1143733463 17:8894364-8894386 TGGAGCTAAGGCAAAGTGGATGG - Intronic
1146272453 17:31493309-31493331 TTGAGGTACCAGAAAGAGGAAGG + Intronic
1147456392 17:40540880-40540902 CTGAGTTATGAGAAAGTTTAGGG + Intergenic
1151176430 17:72292212-72292234 TTGAGAGATGAGAAAGAAGATGG - Intergenic
1152301765 17:79498984-79499006 TGGACATATGAGTAAGTGGATGG - Intronic
1153488194 18:5623322-5623344 CTGAGTTATGAGAAATTGAATGG - Intronic
1154476757 18:14767662-14767684 TTGAGCCATGATAATGTTGATGG + Intronic
1154481209 18:14827152-14827174 TTGAGCCATGATAATGTTGATGG + Intronic
1155175921 18:23300950-23300972 TTGAGCTAGTAGACAGAGGATGG + Intronic
1156501319 18:37560955-37560977 TTTAGCTGTGTGAAAGAGGAAGG - Intronic
1157591011 18:48836473-48836495 TTGAGGTGTGAGAAGCTGGAGGG - Intronic
1157689400 18:49668811-49668833 GTGAGCTATGTGCAAGTGGCAGG + Intergenic
1158363897 18:56708445-56708467 TTGAGGAGTGAGAAAGTAGAAGG + Intronic
1159643693 18:70892398-70892420 TTGAGCCATCAGAGAGTGCATGG + Intergenic
1159713619 18:71794402-71794424 TTGAACTATAAGAAACTGTATGG - Intergenic
1161627552 19:5336044-5336066 TAAAGCGATGTGAAAGTGGAGGG + Intronic
1165925244 19:39322022-39322044 TTCAGCTATGGGACAGGGGATGG - Intergenic
1166308799 19:41950812-41950834 TTGGGGTAGGAGAAATTGGAGGG - Intergenic
1167724152 19:51199598-51199620 TTGATCCAAGAGAAAGTGGGCGG - Intergenic
925306483 2:2850758-2850780 TTGTGCTAGGAGTAAGTGGCAGG - Intergenic
926488367 2:13491865-13491887 TTGTGCTGTGAGAGAGTGTATGG - Intergenic
927061654 2:19428618-19428640 CTGAGATATGAGTATGTGGATGG - Intergenic
927571955 2:24167659-24167681 TGGAGCTATAAGAAAGAAGAGGG + Exonic
927735188 2:25514356-25514378 TAGAGCAATGGGAAAGTGGCAGG + Intronic
928787057 2:34900848-34900870 TTGTGGTGTAAGAAAGTGGAAGG - Intergenic
930920119 2:56743070-56743092 GTGAGCTATGAGAGACAGGATGG + Intergenic
931753497 2:65351139-65351161 TCCAGCTATCAGAGAGTGGAGGG + Intronic
935699245 2:105796712-105796734 TAGAGGTATGAGAAAGTACAAGG - Intronic
939814087 2:146872370-146872392 TTGGGCTATGAGATAAGGGAAGG + Intergenic
940210431 2:151251219-151251241 CTGAGTCAGGAGAAAGTGGATGG - Exonic
940268724 2:151868236-151868258 TTTAGCAAAGAGAAAGTGAATGG + Intronic
941030962 2:160511176-160511198 TAGAGCTATGACAAAGTCCAGGG - Intergenic
942058676 2:172207936-172207958 TTGAGTTATGATGAAATGGATGG - Intergenic
942404061 2:175634350-175634372 TTGAGGTAGGAGATAGAGGATGG - Intergenic
942667948 2:178342024-178342046 ATGAGGTAGGAGAAAGTGGTGGG - Intronic
943188620 2:184647052-184647074 TTGATCTATGAGCCAGTTGATGG - Intronic
943794501 2:191975411-191975433 TTGAGTTTGGAGAAAGTTGAGGG - Intronic
945424553 2:209684168-209684190 CTGAGCTATTAGAATTTGGAAGG + Intronic
946362971 2:219230059-219230081 TGGGGGTTTGAGAAAGTGGACGG + Intronic
1170008045 20:11690276-11690298 TTGTGCCATGAGTAAATGGATGG + Intergenic
1170415225 20:16132589-16132611 TTGAGCTACAAGTAAGAGGAAGG + Intergenic
1173468042 20:43299978-43300000 CAGAGCCATGTGAAAGTGGAAGG + Intergenic
1173639850 20:44593556-44593578 TTGAACTAAGAGAGAGTAGAAGG + Intronic
1175655839 20:60769707-60769729 ATGAGAAATGAGAGAGTGGAGGG - Intergenic
1176589610 21:8633148-8633170 TTATGGTATGAGGAAGTGGAGGG - Intergenic
1176739656 21:10589317-10589339 TTGACCTATGAGCCAGTAGATGG + Intronic
1176799393 21:13409454-13409476 TTGAGCCATGATAATGTTGATGG - Intergenic
1177205204 21:18002376-18002398 TAGAACTAAGAGAAAATGGAAGG - Intronic
1177851799 21:26358012-26358034 TTAAGCTATCATAAACTGGATGG - Intergenic
1178477036 21:32946087-32946109 TTGAGTTATGACAAAGAGGTGGG - Intergenic
1180186112 21:46140162-46140184 GTGAGCAATGTGAAGGTGGACGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180272440 22:10610142-10610164 TTATGGTATGAGGAAGTGGAGGG - Intergenic
1181323372 22:22025745-22025767 CTGGGCTCTGAGACAGTGGAGGG + Intergenic
1181394586 22:22611069-22611091 TTGAGCTTCGTGAAAATGGATGG - Intergenic
1181468952 22:23126436-23126458 TTGAGCTGTGAGGATGGGGAAGG - Intronic
949137689 3:588574-588596 TTATGGTATGAGGAAGTGGAGGG + Intergenic
949719620 3:6973773-6973795 TTGAGCTAAGGGAATGTGAAAGG + Intronic
950456992 3:13098635-13098657 CTGAGCTAGGGGAAAATGGATGG + Intergenic
951469063 3:23035908-23035930 TTGAGCTCTGAGAATGAGAATGG - Intergenic
955391681 3:58526652-58526674 TGGAGCTGTGAGAACATGGAGGG + Exonic
956351523 3:68342057-68342079 TTGAGCTATGAATGGGTGGAAGG + Intronic
960195170 3:114757460-114757482 CAGAGTTATGAGAAATTGGAAGG - Intronic
962682728 3:137816417-137816439 GTGAGCAATGAGAAAATGAAAGG + Intergenic
962921853 3:139957535-139957557 ATGAGCTATGTGAAGGTGCAGGG + Intronic
963727399 3:148937712-148937734 TGAAGGTTTGAGAAAGTGGATGG + Intergenic
965761742 3:172085105-172085127 TTCAGCTTTGAGCAAGTGGTGGG + Intronic
966200518 3:177356423-177356445 CTGAGCTAGGAGAAGGTGGAGGG + Intergenic
968589499 4:1450333-1450355 CTGAGCTCTGGGAAAGGGGAGGG + Intergenic
969106623 4:4811410-4811432 TTGAGGGATGAGGAAATGGAGGG - Intergenic
969577008 4:8042112-8042134 TTGACCTAAGGGAGAGTGGAAGG + Intronic
971564392 4:28118912-28118934 TTGAGCTGTGAAAAAGTGAGGGG + Intergenic
971824720 4:31606268-31606290 TTAAGGTATGAGACAATGGATGG - Intergenic
972010960 4:34181382-34181404 TTGTGGTATGAGGAAGTAGAGGG + Intergenic
972816436 4:42651682-42651704 TTTAGCCAGGAGAAAATGGAAGG - Intronic
974464291 4:62233950-62233972 AGGAGCTATGAGCAAGTTGAAGG - Intergenic
975426093 4:74229656-74229678 TAGTACTATGAGAAACTGGAGGG - Intronic
975838674 4:78451572-78451594 TTTGGTTATGAGAAAGTAGATGG + Intronic
976337129 4:83902107-83902129 GTAAGTTATGAGAAAGTGAAAGG - Intergenic
976549310 4:86376722-86376744 TTTAGCTTTGGGAAAGTGAATGG - Intronic
978759835 4:112344735-112344757 TTTAGAGATGAGAAAGTTGAGGG - Intronic
980670157 4:135994641-135994663 TGGAGCTGTGAGAAAGAAGAAGG - Intergenic
981588920 4:146335065-146335087 ATGAGCTATGACGATGTGGATGG + Intronic
981602754 4:146509100-146509122 GTGAGATATGTGAAAGTGGTTGG - Intronic
982636812 4:157907180-157907202 ATGAGGTATGAGAAAAAGGAAGG + Intergenic
984211010 4:176848475-176848497 TTGAACAATGAGAAAGGAGAAGG - Intergenic
987179035 5:15347117-15347139 CAGAGCTATCAGAAAGTAGATGG - Intergenic
988871069 5:35390565-35390587 GGGACCTATGGGAAAGTGGAGGG + Intergenic
989593990 5:43138671-43138693 GTCAGCTATTAGAAAGTGCAGGG + Intronic
990530983 5:56673484-56673506 GTGAGCGAGGAGACAGTGGAAGG + Intergenic
990547632 5:56838913-56838935 TTGAGCTAGGAGCAAATGGCTGG + Intronic
991036715 5:62134794-62134816 TTGTGCTCTGAGAAAGTGACTGG + Intergenic
994240270 5:97411202-97411224 TTGAGTTGTGACAGAGTGGATGG - Intergenic
994276723 5:97847277-97847299 TTGAGCGATGAAATAGTGTATGG - Intergenic
994525291 5:100900004-100900026 TGGAGATATGAGAATGTGGATGG + Intronic
995050619 5:107698747-107698769 TTGAGCTGTGACTAAATGGAAGG - Intergenic
995214157 5:109575415-109575437 GTGAGCAAAGAGAAAGTAGATGG - Intergenic
995288688 5:110423204-110423226 AGCAGCTATGAAAAAGTGGAAGG + Intronic
995339552 5:111042468-111042490 ATGAGTTATAAGAAAGTGAATGG - Intergenic
996267529 5:121559918-121559940 TTGAGAGATAACAAAGTGGAAGG + Intergenic
996735243 5:126752355-126752377 TTTAGTTATGAGAAAGTGAATGG + Intergenic
997890239 5:137670020-137670042 ATGTGCTATGAGTAAGGGGAAGG + Intronic
998239666 5:140428684-140428706 TGGAGCTATGAAAAAGTTCAAGG - Intronic
1004258337 6:14085363-14085385 GTGGGCGATGAGAAAGAGGAAGG - Intergenic
1004571915 6:16854394-16854416 TTGAGTTAGGAGAATGAGGAAGG + Intergenic
1004759921 6:18655334-18655356 TTAAGCAATGAGAAACAGGAGGG - Intergenic
1005583757 6:27256670-27256692 TAGAGCTGTGAGAAAGAGAATGG - Intergenic
1006204850 6:32331602-32331624 TTCAGCTGGGAGAAAGTGCAAGG + Intronic
1007348505 6:41251240-41251262 TTCAGTGATGAGAAGGTGGAAGG - Intergenic
1007954279 6:45902195-45902217 TTGAGCTATGAGAAAGTGGATGG - Exonic
1008102196 6:47404011-47404033 GTGAGATATGAGGAGGTGGATGG - Intergenic
1011414916 6:87108255-87108277 TTAAGCTCTGAAAAAGTGGAAGG + Intergenic
1011563561 6:88648878-88648900 ATCAGCTATGAGTAAGTTGAAGG + Intronic
1011623558 6:89265079-89265101 TTGGGCTTTGAGAAAGGTGAGGG - Intronic
1011960954 6:93089309-93089331 TTGCAATATGAGAAGGTGGAAGG + Intergenic
1012847529 6:104409692-104409714 TTTAGCTATAATAAAATGGAAGG + Intergenic
1013478309 6:110529934-110529956 TTAAGCTCTGAGAAAGTGTGTGG + Intergenic
1013840375 6:114385032-114385054 TTGAGATATGAGCTATTGGAAGG + Intergenic
1015058788 6:128936877-128936899 TTGAGCTATGACAATGTTGATGG + Intronic
1015345385 6:132150827-132150849 TTGAGGAATGAGATATTGGATGG + Intergenic
1017006185 6:150029338-150029360 TAGGGGTATGGGAAAGTGGATGG + Intergenic
1018515733 6:164578117-164578139 TTAAGATATGAGAAAGTTGAGGG - Intergenic
1018571897 6:165220655-165220677 ATGAGCAATGATAAATTGGAAGG + Intergenic
1020727104 7:11829950-11829972 ATGAGTTATGAGAAAGTGATTGG - Intronic
1020972563 7:14964122-14964144 TTGAGTTATGAGTAAGAAGAAGG + Intronic
1022135076 7:27439463-27439485 TTGATCTGTGGGAAAGAGGAAGG - Intergenic
1022952641 7:35353169-35353191 TTGACCAATAGGAAAGTGGATGG + Intergenic
1026363454 7:69624564-69624586 TTAAGCTGTGTGCAAGTGGAGGG + Intronic
1031250930 7:119379424-119379446 TTGAGAAATGAAAAAGTGGCAGG + Intergenic
1031339023 7:120575863-120575885 TTTAGATATGAGAAAGCTGAGGG - Intronic
1032492185 7:132331887-132331909 TGCATCTGTGAGAAAGTGGAAGG + Intronic
1032781563 7:135168635-135168657 TTGAGCTTTTAGAAGGTGGAGGG - Intronic
1032795770 7:135275197-135275219 TGGAGCTATGAGAAAATGCAAGG + Intergenic
1033521378 7:142164240-142164262 TTGAGCTATGACAAAGAAGAAGG - Intronic
1033595825 7:142856997-142857019 CTGAGAGATGAGTAAGTGGAAGG - Intronic
1035711950 8:1724253-1724275 TTTAATTATGAGAAACTGGAAGG + Intergenic
1038413765 8:27378163-27378185 GGGAGATATGAGACAGTGGAGGG - Intronic
1042599593 8:70485436-70485458 TGGAGCAATGAGAAATGGGAGGG + Intergenic
1046388566 8:113537244-113537266 TGGGGCTATCAGAGAGTGGAGGG - Intergenic
1047006048 8:120621451-120621473 GTGAGAAATGGGAAAGTGGAGGG + Intronic
1047367885 8:124228996-124229018 GTGAGCTTGGAGAAAGTAGAAGG + Intergenic
1048736843 8:137511581-137511603 TTGACGTATGAGAATCTGGAAGG - Intergenic
1050716822 9:8538122-8538144 ATGAGATTTGTGAAAGTGGATGG - Intronic
1054885842 9:70197799-70197821 ATGAGCTATGACGATGTGGATGG - Intronic
1055447998 9:76402202-76402224 TTAAGCTAAGAGCAAGTGGGAGG - Intergenic
1061102275 9:128501197-128501219 TTTAGCTATTAGGAAGAGGATGG + Exonic
1061656233 9:132092563-132092585 TTGAGCTGGGAGATGGTGGATGG + Intergenic
1203619623 Un_KI270749v1:111776-111798 TTATGGTATGAGGAAGTGGAGGG - Intergenic
1185975662 X:4716933-4716955 TTTAGCTATGAGAAACTGCTAGG + Intergenic
1186800994 X:13092399-13092421 TTGAGTTTTGAGAACATGGAAGG - Intergenic
1187303568 X:18074580-18074602 TTATGCTATGAAAAAGTGCAGGG + Intergenic
1188160214 X:26791202-26791224 TTGACATATGAGAACATGGAAGG + Intergenic
1191056317 X:56244957-56244979 TTGAGGTATTAGAAAATGGTTGG + Intronic
1191601247 X:63011628-63011650 ACAAGCCATGAGAAAGTGGAAGG - Intergenic
1195245721 X:102993407-102993429 TTGAGCTGAGATAAAATGGATGG + Intergenic
1200907942 Y:8503980-8504002 TTGAGATATCAGAATCTGGATGG - Intergenic
1201912669 Y:19149101-19149123 TTGAGCAATAAAAAATTGGAAGG - Intergenic