ID: 1007955931

View in Genome Browser
Species Human (GRCh38)
Location 6:45917908-45917930
Sequence CAGAGTAATTATGTGGAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 155}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007955931_1007955943 30 Left 1007955931 6:45917908-45917930 CCTCACTCCACATAATTACTCTG 0: 1
1: 0
2: 0
3: 19
4: 155
Right 1007955943 6:45917961-45917983 CAGCAAGTGAGCCTAGGGTTGGG 0: 1
1: 0
2: 1
3: 12
4: 141
1007955931_1007955934 -9 Left 1007955931 6:45917908-45917930 CCTCACTCCACATAATTACTCTG 0: 1
1: 0
2: 0
3: 19
4: 155
Right 1007955934 6:45917922-45917944 ATTACTCTGAGTAGTTAGATGGG No data
1007955931_1007955935 -8 Left 1007955931 6:45917908-45917930 CCTCACTCCACATAATTACTCTG 0: 1
1: 0
2: 0
3: 19
4: 155
Right 1007955935 6:45917923-45917945 TTACTCTGAGTAGTTAGATGGGG No data
1007955931_1007955940 24 Left 1007955931 6:45917908-45917930 CCTCACTCCACATAATTACTCTG 0: 1
1: 0
2: 0
3: 19
4: 155
Right 1007955940 6:45917955-45917977 CAACTACAGCAAGTGAGCCTAGG 0: 1
1: 0
2: 1
3: 9
4: 130
1007955931_1007955941 25 Left 1007955931 6:45917908-45917930 CCTCACTCCACATAATTACTCTG 0: 1
1: 0
2: 0
3: 19
4: 155
Right 1007955941 6:45917956-45917978 AACTACAGCAAGTGAGCCTAGGG 0: 1
1: 0
2: 0
3: 11
4: 110
1007955931_1007955942 29 Left 1007955931 6:45917908-45917930 CCTCACTCCACATAATTACTCTG 0: 1
1: 0
2: 0
3: 19
4: 155
Right 1007955942 6:45917960-45917982 ACAGCAAGTGAGCCTAGGGTTGG 0: 1
1: 0
2: 0
3: 13
4: 155
1007955931_1007955936 -7 Left 1007955931 6:45917908-45917930 CCTCACTCCACATAATTACTCTG 0: 1
1: 0
2: 0
3: 19
4: 155
Right 1007955936 6:45917924-45917946 TACTCTGAGTAGTTAGATGGGGG 0: 1
1: 0
2: 0
3: 6
4: 93
1007955931_1007955933 -10 Left 1007955931 6:45917908-45917930 CCTCACTCCACATAATTACTCTG 0: 1
1: 0
2: 0
3: 19
4: 155
Right 1007955933 6:45917921-45917943 AATTACTCTGAGTAGTTAGATGG 0: 1
1: 0
2: 0
3: 7
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007955931 Original CRISPR CAGAGTAATTATGTGGAGTG AGG (reversed) Intronic
902796860 1:18805795-18805817 CAGAGAAATTAGGCAGAGTGGGG + Intergenic
903588190 1:24433253-24433275 CACAATAAGTGTGTGGAGTGTGG - Intronic
906419738 1:45655229-45655251 CAGAGGAATTATGTCGACGGCGG + Exonic
906946857 1:50301712-50301734 CAGAGTGTTTGTGGGGAGTGGGG - Intergenic
907247537 1:53117672-53117694 CTGAGGGATTGTGTGGAGTGGGG + Intronic
909699298 1:78503663-78503685 CAGAGGAAGCATGTGGAGTTTGG - Intronic
910473876 1:87585606-87585628 CTGAGTGCTTATGTCGAGTGGGG + Intergenic
913517791 1:119619069-119619091 GAGAGCAATTAATTGGAGTGAGG - Intergenic
915518868 1:156429861-156429883 TAGAGTGATTAAGTGGTGTGTGG + Intronic
915747287 1:158173138-158173160 CAGAGCAATTTTGGGGTGTGTGG + Intergenic
917254884 1:173103691-173103713 CAGTGGAATGATGTGGAGTTTGG - Intergenic
919048707 1:192485785-192485807 TAGACTTATTATTTGGAGTGTGG + Intergenic
922210179 1:223480275-223480297 GAGGGTAATTTTGTGGTGTGGGG + Intergenic
923018406 1:230144757-230144779 CAGTGTTCTTATGTGGGGTGAGG + Intronic
923489233 1:234468730-234468752 CAGAGTTGGTGTGTGGAGTGGGG - Intronic
924427306 1:243964179-243964201 CAGAGTAAATATTTGTAGTCTGG + Intergenic
1063991264 10:11566386-11566408 CACAGTAAATATGTGGCGTTTGG - Intronic
1066624461 10:37392166-37392188 AATAATAATTATTTGGAGTGGGG - Intergenic
1067530013 10:47063607-47063629 CAGAGAAAGTATATGGAGTGGGG - Intergenic
1071259655 10:83908451-83908473 CAGAGCAGTTATCTGAAGTGGGG - Intergenic
1071732563 10:88263265-88263287 CAGAGAAATTATATGGTGTCTGG + Intergenic
1071938273 10:90555551-90555573 CAGAGTCATGGTGTGGACTGGGG - Intergenic
1073674962 10:105635664-105635686 CAAAGGAATTATGATGAGTGTGG - Intergenic
1076274725 10:129187469-129187491 CCAAGAAACTATGTGGAGTGAGG + Intergenic
1077844111 11:6006050-6006072 AAGAGTAATTTTGAGGGGTGAGG + Intergenic
1077959886 11:7064399-7064421 CAAAATAATTATGTGGTCTGTGG - Intronic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1080257169 11:30303615-30303637 CATAGGGATTATGTGCAGTGTGG - Intergenic
1082757805 11:57095419-57095441 AAGAGTATTGATGTGGAGGGAGG + Intergenic
1085668112 11:78434394-78434416 CATATTAATTTTGTGGAATGAGG - Intergenic
1085802133 11:79600529-79600551 CCCTCTAATTATGTGGAGTGGGG - Intergenic
1087166103 11:95004845-95004867 AAGAGTAATTATGTCTAGTTTGG - Intergenic
1088480183 11:110289620-110289642 CAGAGTCCTTATGTTGACTGGGG + Intronic
1088532602 11:110827075-110827097 CAGGGAAATAATGTGGGGTGAGG + Intergenic
1095945121 12:47749327-47749349 CAGAGAAGTGATGTGGAGAGAGG - Intronic
1098351109 12:69561745-69561767 AAGAGGAATTATGGTGAGTGAGG + Intronic
1099226972 12:79981440-79981462 CAGAAGAATTATGTGGACTATGG + Intergenic
1100761605 12:97813353-97813375 CAGTGTAAGTATGTGAAGTTTGG - Intergenic
1104893420 12:132150891-132150913 GAGTGTAAGTCTGTGGAGTGTGG - Intronic
1106141136 13:27013070-27013092 CCGAGTGATTTTGTGGTGTGTGG - Intergenic
1112470011 13:99679592-99679614 CTGAGTAATTATGTAGAGGGTGG + Intronic
1113616139 13:111681822-111681844 CAGAGTAACGCTGTGCAGTGTGG - Intergenic
1113621607 13:111766715-111766737 CAGAGTAACGCTGTGCAGTGTGG - Intergenic
1114166589 14:20224900-20224922 CTGAGTAGTTATGTGGTGGGTGG + Intergenic
1116115896 14:40650262-40650284 AAGAGGAATTATGGTGAGTGAGG + Intergenic
1118692562 14:68353833-68353855 AAGCATAGTTATGTGGAGTGTGG - Intronic
1120508131 14:85378713-85378735 CAGAGTGAATACGTGCAGTGAGG - Intergenic
1120905458 14:89617058-89617080 TAGAGTATGTATGTGTAGTGGGG + Intronic
1122646927 14:103201052-103201074 CAGAAGAATTAGGTGGGGTGGGG - Intergenic
1126610873 15:50528262-50528284 AAAAGTAATTATGTGCAGTATGG - Intronic
1127860741 15:62992328-62992350 AAGAGGAATTATGTGAAATGGGG - Intergenic
1133894446 16:9912498-9912520 CAGAGTAAGTGGGTGGGGTGGGG + Intronic
1137897453 16:52229339-52229361 CTGATTAAATATGTGGAGTGAGG - Intergenic
1138947545 16:61870361-61870383 CAGTGTAAATGTGTGAAGTGAGG + Intronic
1141633345 16:85301034-85301056 CAGGGGAATTCTGTGTAGTGGGG - Intergenic
1142931967 17:3292731-3292753 CAGAGTAAACAAGTGTAGTGTGG - Intergenic
1143292370 17:5841038-5841060 CAGAGGAAGGATGTGGAGTTTGG - Intronic
1149987129 17:61355764-61355786 CAGACTAATTATTTGGAATGAGG + Intronic
1150624546 17:66833364-66833386 AAGAGTAAGTGTATGGAGTGGGG - Intergenic
1153286349 18:3458423-3458445 CAGAGTATTTCTGTTGAGGGAGG + Intronic
1154178116 18:12102155-12102177 CCGAGTAACTATGAAGAGTGAGG + Intronic
1154394174 18:13971637-13971659 CAGAGTATTTATGCCAAGTGTGG - Intergenic
1155601574 18:27554829-27554851 CAAAATAATTATGTGGACTAAGG - Intergenic
1157104706 18:44762903-44762925 CAGAGTATTTATTTGGTGTAAGG + Intronic
1157552495 18:48591210-48591232 CAGGGTAATTATAATGAGTGAGG - Intronic
1157971745 18:52277778-52277800 AAGATGAAGTATGTGGAGTGGGG + Intergenic
1159663789 18:71131747-71131769 CAGACTCATTATGTGGAATTGGG + Intergenic
1159724189 18:71933402-71933424 TAGATTAATTCTGTGGAGTGTGG + Intergenic
1160175030 18:76586306-76586328 CATAGTTATGATGTGGACTGAGG + Intergenic
1160319466 18:77876698-77876720 AAGGGTTATTATGTGGAGGGTGG - Intergenic
1166661088 19:44647710-44647732 CAGCGCAATGATGTGGGGTGGGG + Intronic
1168083664 19:54029233-54029255 CAGAGTAGTTATATGGGGTGAGG + Intergenic
925914037 2:8591964-8591986 AAGAGTAATTATAAGGGGTGGGG - Intergenic
927810982 2:26180036-26180058 CAGAGGAAAAATGTGGAGGGGGG - Intronic
930988528 2:57620686-57620708 CAGTTTAATTATTTAGAGTGTGG - Intergenic
932438044 2:71714575-71714597 CAGAGAAATTACCTTGAGTGAGG - Intergenic
934055182 2:88245441-88245463 CACAATAAGTATGTGCAGTGAGG + Intergenic
939000555 2:136729183-136729205 CAGTGGAATCCTGTGGAGTGAGG + Intergenic
942527134 2:176865904-176865926 AAGAATAATAATGTGTAGTGGGG + Intergenic
942690779 2:178582610-178582632 AAGAGTGAATATGTGGAATGGGG + Intronic
942721724 2:178960463-178960485 GGGAGAAATTATGTGGAGGGAGG - Intronic
942810812 2:179998369-179998391 CAGGGTAATTATGAGGATTGAGG - Intronic
943483072 2:188446252-188446274 AAGAGTAATCATGTGGAGGATGG + Intronic
943505218 2:188747091-188747113 CAGACTCAGTAGGTGGAGTGAGG - Intronic
944136585 2:196406264-196406286 AAAAGTAATTATGGGGAATGAGG - Intronic
944378831 2:199082344-199082366 CACAGTAACTATCTGGAGTTTGG + Intergenic
944920147 2:204404304-204404326 AAGAGAAATTATGAGGATTGGGG - Intergenic
947310056 2:228791653-228791675 CAGAGTAGTCATGTTCAGTGAGG - Intergenic
948513931 2:238491085-238491107 CCGAGTAATTGTATGGAGAGGGG - Intergenic
948609684 2:239158893-239158915 GAGAGTAATTGTGTGCGGTGCGG - Intronic
1168990880 20:2095037-2095059 AAGAGGGATTATGCGGAGTGAGG - Intergenic
1172303127 20:33863541-33863563 CAGAGAAAATTGGTGGAGTGGGG - Intergenic
1173449281 20:43148181-43148203 CAGATTGATTTTGTGGAGTTGGG - Intronic
1175562537 20:59942570-59942592 CAGATTGAATATGTGGAGTGGGG + Intronic
1180819538 22:18816591-18816613 CAGAGTGAGTAGGTGGAGTGGGG - Intergenic
1180904517 22:19399555-19399577 CAGAGTAATAATCTGGAGTATGG - Intronic
1181205764 22:21251036-21251058 CAGAGTGAGTAGGTGGAGTGGGG - Intergenic
1203221157 22_KI270731v1_random:44377-44399 CAGAGTGAGTAGGTGGAGTGGGG + Intergenic
1203269668 22_KI270734v1_random:42444-42466 CAGAGTGAGTAGGTGGAGTGGGG - Intergenic
950785402 3:15430131-15430153 AAAAGTAATTTTGGGGAGTGGGG + Intronic
951272907 3:20649524-20649546 GAAATAAATTATGTGGAGTGGGG - Intergenic
952694011 3:36244756-36244778 CACAGAAATTGTGTGGAGTTCGG - Intergenic
956648586 3:71481909-71481931 AAGAGTGAATTTGTGGAGTGGGG - Intronic
961408055 3:126697095-126697117 CACAGTACTTATGTGGGATGGGG - Intergenic
962250688 3:133834311-133834333 CAGAGTGATGCTGTGGGGTGGGG - Intronic
964529974 3:157657059-157657081 CAGAGCAATTATTTGTAGTCTGG - Intronic
965784419 3:172320707-172320729 CAGTGTAATTCTGTAGACTGTGG - Intronic
966056137 3:175692885-175692907 CAGAGTAATTATGGGTCTTGTGG - Intronic
967153321 3:186669466-186669488 CAAAGTAATTACTTGCAGTGAGG + Intronic
968274978 3:197434088-197434110 GAGACTAGTTATGTGGAGAGAGG - Intergenic
968274983 3:197434146-197434168 GAGACTAGTTATGTGGAGAGAGG - Intergenic
968274985 3:197434168-197434190 AAGACTAGTTATGTGGAGGGAGG - Intergenic
968274990 3:197434212-197434234 GAGACTAGTTATGTGGAGGGAGG - Intergenic
969408618 4:7013111-7013133 TAGAGTCATAATGTTGAGTGGGG + Intronic
969539810 4:7780666-7780688 CAGAGTAATTTTGTGGTGTTAGG - Intronic
971511391 4:27429622-27429644 ATGAGTAATTATGTCAAGTGAGG - Intergenic
972484144 4:39526722-39526744 CAGAGCAATTCTGTGGTGTAGGG + Intronic
972725179 4:41741191-41741213 GTGAGTAATTATGTAGAGTATGG - Intergenic
973270003 4:48253301-48253323 CAGAGTAGTTATGTGGAAGCAGG - Intronic
978413075 4:108446434-108446456 CAGAATAAATAAGTGAAGTGGGG - Intergenic
980269356 4:130563984-130564006 AAGAGCACTTATGTGGAGAGTGG + Intergenic
981821613 4:148893740-148893762 CAGAGTATTTTTGTGGAGTCAGG + Intergenic
984681429 4:182614683-182614705 AAGAGTAATTAAGTGGTATGAGG - Intronic
984865029 4:184273925-184273947 CTGAGTAATTCTGTGGCATGGGG - Intergenic
984973710 4:185211213-185211235 CAGAGTAGTTTGGTGAAGTGTGG - Intronic
987968311 5:24906669-24906691 TAGAGTTATTCTGTTGAGTGTGG - Intergenic
989546252 5:42677186-42677208 AAGAGTAATGAAGTGGAGTTTGG - Intronic
989666190 5:43857169-43857191 CAGAGTAATTCTTTGTCGTGGGG - Intergenic
990810760 5:59720313-59720335 CAGGCTAATTATGTAGAGAGAGG + Intronic
992232667 5:74678973-74678995 AAGATTAATAATGTGGAATGAGG + Intronic
992671341 5:79063979-79064001 CAGAATCATTATATGGAATGGGG - Intronic
992677807 5:79123252-79123274 CAGAGGAATGAAGGGGAGTGAGG + Intronic
995821847 5:116243909-116243931 CATCTTAATTATGGGGAGTGGGG - Intronic
998659695 5:144222345-144222367 AAAAGTAATAATGTGGTGTGGGG + Intronic
999664972 5:153903584-153903606 CAGATTAGTGATGTGGAGTGAGG - Intergenic
1001680341 5:173552386-173552408 CAGAGCTAGTATGAGGAGTGGGG + Intergenic
1002552900 5:180010279-180010301 CAAGGTAATTATGCTGAGTGAGG + Intronic
1002650892 5:180692783-180692805 CATAGAAATTATTTGGAGAGTGG - Intergenic
1007870454 6:45030701-45030723 TAGAATAATTATGGGGAGTAAGG + Intronic
1007955931 6:45917908-45917930 CAGAGTAATTATGTGGAGTGAGG - Intronic
1010050326 6:71496650-71496672 CAGAAAAATTTTGTGGAGTGGGG - Intergenic
1010915526 6:81613307-81613329 TTGAGTAACTATGTGAAGTGCGG + Intronic
1010947700 6:81997588-81997610 CAGAGTAATTATGATGAAAGGGG + Intergenic
1011443530 6:87412593-87412615 CAGAGAAATTTTGTGAAGAGAGG + Intronic
1014048805 6:116927272-116927294 TAGAGTCCTGATGTGGAGTGGGG - Exonic
1024117877 7:46210148-46210170 CAGATTCATTATGTGCACTGGGG + Intergenic
1025004044 7:55341756-55341778 CATTGTATTTATGTGGAGTTTGG + Intergenic
1028415925 7:90580574-90580596 CAGGGTAAGTAGGTGGAGAGTGG - Intronic
1029463317 7:100709114-100709136 CCCAGTAATTATTTGGAGTGAGG - Intergenic
1030635529 7:111944058-111944080 CAGAGGAATTAGGTGAAATGAGG - Intronic
1031859578 7:126962785-126962807 CAGAGCAAATATGTGGGTTGTGG - Intronic
1031922795 7:127613840-127613862 CAGAGCCACTATGGGGAGTGAGG + Exonic
1032508371 7:132452856-132452878 CAGAGTAAATAATTGGTGTGTGG - Intronic
1032661288 7:133986783-133986805 CAGAGAAATTATGAAGACTGGGG + Intronic
1035726000 8:1824834-1824856 CAGAGTAAACAGGTGGGGTGTGG - Intronic
1035726051 8:1824994-1825016 CAGAGTAAACAGGTGGGGTGTGG - Intronic
1035775417 8:2183807-2183829 CAGTGGCATTATCTGGAGTGGGG - Intergenic
1036238915 8:7066770-7066792 CACAGATATTATGTGGAATGGGG - Intergenic
1039172783 8:34767065-34767087 CAGACTAAATATGAGGGGTGTGG + Intergenic
1042984841 8:74571941-74571963 CACAGGAAGTATGTGGAATGAGG - Intergenic
1044599086 8:93985762-93985784 CAGACTCATTAAGTGCAGTGTGG + Intergenic
1045945350 8:107789049-107789071 CAGAGTACTCAGGTGAAGTGTGG - Intergenic
1050569364 9:6921536-6921558 CAGAGTAATAGTGGTGAGTGTGG - Intronic
1055969598 9:81898685-81898707 CAGTGGAAGTATATGGAGTGTGG + Intergenic
1059768791 9:117408623-117408645 CAGAGTAATTTTGCAGACTGAGG + Intronic
1061532294 9:131224072-131224094 CTGTGTACTTATGTGGATTGTGG - Intronic
1187444972 X:19353000-19353022 CAGAGTACATATTTGGGGTGCGG + Intronic
1192411107 X:70933213-70933235 AATAGTAATTATGTGAGGTGAGG + Intergenic
1192894438 X:75426354-75426376 GAGAGTAATTGGGTGGGGTGAGG - Intronic
1193900754 X:87173815-87173837 CAGAATAATCATGGGCAGTGTGG + Intergenic
1193968991 X:88027036-88027058 ATGAGTACTTATGTGGGGTGGGG - Intergenic
1194418123 X:93638107-93638129 CAGAATAAATATGTGGGGTTGGG + Intergenic
1194956204 X:100183700-100183722 GAGAGTAATGATGGGGATTGTGG - Intergenic
1196614739 X:117755192-117755214 CAGAGTAATAAAATGGAGTGGGG + Intergenic
1198031765 X:132760193-132760215 CAGAGCAGTAATGTGGGGTGAGG + Intronic