ID: 1007956125

View in Genome Browser
Species Human (GRCh38)
Location 6:45919363-45919385
Sequence CAGAGTAACCATGGGGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 141}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007956125 Original CRISPR CAGAGTAACCATGGGGATGC TGG Intronic
900424568 1:2570200-2570222 AAGAGTAACCATGGGAATGTGGG + Intergenic
901186324 1:7375668-7375690 CTGGGTAACCATGGGGACACAGG - Intronic
902575096 1:17372618-17372640 CTGTGAAACCATGGGGACGCTGG + Intronic
905360460 1:37415962-37415984 ATGAGTCACCATGCGGATGCTGG - Intergenic
906289881 1:44612962-44612984 CAGAGCATCCATGGATATGCAGG + Intronic
906289894 1:44613038-44613060 CAGAGCATCCATGGATATGCAGG + Intronic
906289908 1:44613114-44613136 CAGAGCATCCATGGATATGCAGG + Intronic
906289921 1:44613190-44613212 CAGAGCATCCATGGATATGCAGG + Intronic
906289934 1:44613266-44613288 CAGAGCATCCATGGATATGCAGG + Intronic
906289950 1:44613342-44613364 CAGAGCATCCATGGATATGCAGG + Intronic
908102213 1:60803145-60803167 TACAATAAACATGGGGATGCAGG + Intergenic
916154934 1:161835341-161835363 CAGAGTAAGGCTGGGCATGCTGG - Intronic
916174602 1:162027184-162027206 CAGAGTAACTATGAGGAAACAGG + Intergenic
917794766 1:178525305-178525327 CAGAGTAGGCATGGGGAGGCAGG - Intronic
923144735 1:231190123-231190145 CAGAGTGAGCCTGGGGATTCAGG + Intronic
924390218 1:243546645-243546667 CAGAGCAGCCATGGAGCTGCTGG + Intronic
1064128043 10:12681351-12681373 GAGAGTGATCATGGGGAGGCTGG - Intronic
1065353980 10:24821085-24821107 CAAAGTACCCATGGAGGTGCTGG - Intergenic
1069333257 10:67318579-67318601 CAGAGTGAACATGGAGATGAAGG - Intronic
1069626732 10:69872678-69872700 CCAAGTAACCATGGGGACTCTGG + Intronic
1071487355 10:86111310-86111332 CATAGCAAGCATGTGGATGCAGG + Intronic
1074561101 10:114535936-114535958 CAGATTTACCAGGGGGATGGTGG + Intronic
1075836287 10:125455785-125455807 CAGAGTAAACATCGCGATACAGG + Intergenic
1076883183 10:133249379-133249401 CATAGGGACCATGGGGATGATGG + Intergenic
1078511245 11:11985836-11985858 CAGCAAAACCATGGGGATGCGGG + Intronic
1079201855 11:18383479-18383501 CATGGTTACCATGGAGATGCTGG + Intergenic
1080779533 11:35418452-35418474 CAGAGTCGCCATGGAGATGCTGG - Intronic
1081714907 11:45243069-45243091 CAGAGTCACTTTGGTGATGCTGG + Exonic
1083363575 11:62128152-62128174 CAGAGCCACCATGGGGACGACGG + Exonic
1084371071 11:68743849-68743871 CAGTGTAACAAAGGAGATGCAGG + Intronic
1086413449 11:86566172-86566194 CACAGTCCCCATGGGGATTCTGG - Intronic
1089219381 11:116858238-116858260 CACATGAACCAAGGGGATGCGGG - Exonic
1090219606 11:125007527-125007549 CACAGTAAACATGGGGATACAGG + Intronic
1091594119 12:1864410-1864432 CAGAGTAACTATGGAAATGACGG - Intronic
1094004464 12:25734028-25734050 CAGAGTAACCATGGGCCTCAGGG - Intergenic
1102261617 12:111446629-111446651 GAGAGTATCCATGGTGTTGCTGG - Intronic
1109219407 13:59626072-59626094 CAGTGTCCCCATGAGGATGCTGG - Intergenic
1110833349 13:80056867-80056889 CAAGGTAAACATGGGGATGCAGG - Intergenic
1113793114 13:113041195-113041217 CAGAGTCACCAGAGGGATGAAGG - Intronic
1119730337 14:76947276-76947298 CTGAGTAACCATGTGGTGGCAGG + Intergenic
1121730803 14:96185717-96185739 CAGAGTGACCTTGGGGAGGCGGG + Intergenic
1125606739 15:40943767-40943789 CAGAGAAACTTTGGGGATGAAGG - Intergenic
1125884431 15:43218086-43218108 TAAAGTAGCCATGGGGAGGCTGG + Intronic
1126378989 15:48026784-48026806 CAGATTAAAAATGGGGATCCTGG - Intergenic
1129332938 15:74837058-74837080 CAGAGTAACCTGAGGGAGGCTGG + Exonic
1130099550 15:80882040-80882062 CAGAGCTACCCTGGGGCTGCTGG + Intronic
1130139269 15:81209837-81209859 CAGTGTAACCATGGCATTGCTGG - Intronic
1130141493 15:81229843-81229865 CAGTGTAACCATGGCATTGCTGG - Intronic
1130692660 15:86097768-86097790 GTGAATAAACATGGGGATGCAGG + Intergenic
1132224354 15:100128827-100128849 CAGAGCAACCATGGGTGGGCAGG + Intronic
1135520814 16:23176580-23176602 CAGATTACCCATGGTGATGGGGG - Intergenic
1137948179 16:52755975-52755997 CAGAGTAACCAGGAGGAGCCAGG + Intergenic
1138239893 16:55418917-55418939 CAGATTAGCCATGGGGATTAAGG - Intronic
1139149863 16:64369443-64369465 CAGATTGACCATGGGGAAGCTGG - Intergenic
1141054938 16:80805030-80805052 CAGAGGCACCATGGGGATCCAGG + Intergenic
1143691696 17:8572677-8572699 CAGAGTCACCATGGTAATGGTGG + Intronic
1144147832 17:12415265-12415287 CATAGAAACCATGGGGTTGAAGG - Intergenic
1145265981 17:21379771-21379793 CAGAGGCACCATGGGGTTGGGGG + Intronic
1146635373 17:34500224-34500246 GAGGGTAGCCATGTGGATGCTGG - Intergenic
1150707055 17:67496522-67496544 CATAGTAAACACGGGGAGGCTGG - Intronic
1152064352 17:78102258-78102280 CAGAGTCACCACGGGGAAGTGGG + Intronic
1153543936 18:6186559-6186581 CACAGTAAGCATGGGAAAGCAGG + Intronic
1156268952 18:35513604-35513626 CAAAGGAACCCTGGGGCTGCTGG - Intergenic
1156951734 18:42908763-42908785 AAGAGTAACCATAGGACTGCTGG + Intronic
1161563486 19:4986552-4986574 CACAGTAAACATGGAGACGCTGG - Intronic
1163737498 19:18990372-18990394 CAGAGGAACCATGGGCAGGCTGG + Intergenic
1164960884 19:32428508-32428530 AAGAGGAACCACTGGGATGCGGG + Intronic
925985813 2:9213792-9213814 CAGCTTCACCATGGGGATGCTGG - Intronic
929640484 2:43573628-43573650 AAGAGTAACCATGAGGTAGCAGG - Intronic
931222657 2:60302075-60302097 CAGAGTGAACTTGGGGAAGCGGG + Intergenic
931288212 2:60850156-60850178 CAGAGTACCCAAGGGGCAGCTGG - Intergenic
932453771 2:71833021-71833043 CAGAGTAGCCCTTGGGAAGCAGG + Intergenic
933502572 2:83133776-83133798 CAGAGTGACCATGGTGATGATGG + Intergenic
933596143 2:84285189-84285211 CACAGTAACCATGGGGATCCAGG + Intergenic
933651294 2:84852387-84852409 CAGAATGACCATGGGGTTACGGG + Intronic
934117881 2:88813173-88813195 CAGAGTAAGTATGGGGTTCCAGG - Intergenic
937402630 2:121598118-121598140 CATAGTGACCATGGGAATCCTGG - Intronic
938671321 2:133589135-133589157 CAGAGAAACCAAGGGGACACAGG + Intergenic
940450726 2:153833112-153833134 CATAGTCAGCATGGAGATGCTGG - Intergenic
941649097 2:168073990-168074012 GAGAGCTACCATGGGGAGGCAGG + Intronic
946097845 2:217291156-217291178 CAAAGCAAGCATGGGGATGGGGG - Intronic
946225591 2:218262640-218262662 CAGAGTTAGGATGGGGCTGCAGG - Exonic
946858950 2:223981522-223981544 CAGAATATCCATGGAGCTGCAGG + Intronic
947713679 2:232329621-232329643 CAGGGAGACCATGGGGGTGCTGG + Intronic
1171391308 20:24803247-24803269 AAGCGTGACCATGGGAATGCTGG + Intergenic
1174203027 20:48820304-48820326 CAGAGTAACCCTAGGAGTGCTGG + Intronic
1174938011 20:54893526-54893548 CAGTGTAACCCTGGGGTTCCAGG + Intergenic
1175468732 20:59210580-59210602 CAGGGTCACCATGAGCATGCAGG - Intronic
1178898796 21:36582869-36582891 CACAGCAACCATGTGGATTCTGG + Intergenic
1180203094 21:46239049-46239071 AAGATCAGCCATGGGGATGCTGG + Intronic
1180723530 22:17927518-17927540 CAGGCTAACCTTGGGGCTGCAGG + Intronic
1182416044 22:30222117-30222139 CAGGAGAACCATGGGGATGTTGG + Intergenic
1182460625 22:30481242-30481264 CAGAGTGGCCATTAGGATGCGGG - Intergenic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
952199335 3:31110271-31110293 CAGGGTAAGCAGGGGTATGCTGG + Intergenic
954747130 3:52793743-52793765 CAGAGAAGCCATGGGTATGGTGG + Intergenic
957769482 3:84671611-84671633 CAGAGTCAGCTTGGGGATCCAGG - Intergenic
960710164 3:120519772-120519794 CAGAGTATCCATGGGGCTTTTGG - Intergenic
962085203 3:132183992-132184014 CACAGGCACCATTGGGATGCTGG - Intronic
963266312 3:143243366-143243388 CAGAGTAATTGTGAGGATGCAGG + Intergenic
967006132 3:185384415-185384437 TGCAGTAAACATGGGGATGCAGG + Intronic
968467855 4:761870-761892 CAGTGACACCATGGGGATGCAGG + Intronic
969176485 4:5402799-5402821 CAGAGCAAGCATGGGGCTGTGGG + Intronic
969462853 4:7337921-7337943 CAGAGGAACCCTGGGCTTGCAGG - Intronic
970631912 4:17956349-17956371 TGCAGTAAACATGGGGATGCAGG - Intronic
978838313 4:113180203-113180225 CACATTAACAATGTGGATGCTGG + Intronic
984356101 4:178660581-178660603 CAGAGTAATAATGGGCAGGCAGG - Intergenic
989534714 5:42550374-42550396 CAGGGGAACCTTGGGGAGGCAGG - Intronic
995605123 5:113845875-113845897 CAGAATATCCCTGGGGATGGAGG - Intergenic
1001428671 5:171642443-171642465 CAGATTACCCATGGCGATGAGGG - Intergenic
1001576196 5:172765514-172765536 CCGCGTTACCATGGGGATGGAGG + Intergenic
1003867299 6:10374970-10374992 CAGAGAGACCATGGGGATTTTGG - Intergenic
1005325049 6:24691987-24692009 GAGACTAAACATGGGGATGGTGG + Intronic
1006231577 6:32592118-32592140 AGGAGTAACCATGGTGATGAGGG - Intergenic
1006572753 6:35018902-35018924 AAGAATAACCATGGAGAAGCAGG - Intronic
1007956125 6:45919363-45919385 CAGAGTAACCATGGGGATGCTGG + Intronic
1008179953 6:48316094-48316116 CAGAGAAACCAAGAGAATGCTGG + Intergenic
1012196371 6:96346187-96346209 CAGAGGAAACATGGTGTTGCAGG + Intergenic
1012585695 6:100919427-100919449 CATAGTAAACAAGGGGATACAGG - Intergenic
1014451827 6:121590973-121590995 CAGAGTAATCAGGGAAATGCAGG + Intergenic
1019051686 6:169188438-169188460 CAGAGTGGCCATGGGGTTGGAGG + Intergenic
1019160996 6:170066738-170066760 CAGAGAAACTCTGGGGAGGCAGG - Intergenic
1020008983 7:4798403-4798425 CAGAGAAACCCTGGGGAAGAGGG - Intronic
1020058641 7:5135974-5135996 CAGAGCAAACATGGGTTTGCTGG - Intergenic
1022683552 7:32573112-32573134 CAGAGTAACTACGGGGAAGGTGG - Intronic
1023719749 7:43080512-43080534 AAGAGTAAGCATGGTGATGATGG + Intergenic
1027191167 7:75996154-75996176 CTAAGTCACCAGGGGGATGCAGG + Intergenic
1028876302 7:95827110-95827132 CAGAGTAAACAAAGGGATGCAGG + Intronic
1030647055 7:112073331-112073353 GACAGTAAACATGGGGATGCAGG - Intronic
1031518309 7:122729317-122729339 CACAATAAACATGAGGATGCAGG + Intronic
1032192155 7:129771498-129771520 CAGGGGAGGCATGGGGATGCAGG - Intergenic
1032749648 7:134825851-134825873 CAGAGGAGCCCTGGGTATGCCGG + Intronic
1033494934 7:141884511-141884533 CAGAAAAACCCTAGGGATGCAGG - Intergenic
1034116683 7:148589729-148589751 CAGAGTAATCTTAGGGATTCTGG + Intergenic
1040513928 8:48119307-48119329 CTGAGTACACATGGGGATGATGG + Intergenic
1041576109 8:59397378-59397400 GAGAGAAAACGTGGGGATGCAGG + Intergenic
1044997725 8:97853178-97853200 CACAGTAATAATGGGTATGCGGG - Intergenic
1045128925 8:99126250-99126272 CAGAGTAAGCATGGGGAAGGAGG + Intronic
1046293226 8:112189719-112189741 CAGAGTAGCCAAGTAGATGCTGG - Intergenic
1047108932 8:121767107-121767129 CTGAGTTCCCCTGGGGATGCAGG - Intergenic
1047531811 8:125683904-125683926 AAGAGTAGCCATGGGGAAGAGGG - Intergenic
1047626041 8:126657109-126657131 AAGAGTAAGAATGAGGATGCTGG - Intergenic
1047867263 8:129040118-129040140 CAAAGTAAGCATGAGGAAGCTGG - Intergenic
1049344805 8:142133168-142133190 CAGAGGAGCCAGGGTGATGCAGG - Intergenic
1049565322 8:143335039-143335061 CAGGGAAACCAGGGGGAGGCCGG - Intronic
1053445637 9:38150940-38150962 CCTGGTAACCATGGGGATGGAGG + Intergenic
1055449061 9:76414508-76414530 CAGAGCAACCAGGGGGCTGCTGG + Intergenic
1057170483 9:92960473-92960495 CAGAATAACCATGGGTAAGATGG + Intronic
1060148998 9:121275378-121275400 CAGTGCAATCATGTGGATGCTGG + Intronic
1060560369 9:124537674-124537696 CAGGCTAGCCATGGGGATGCTGG + Intronic
1061951406 9:133938355-133938377 AAGAGTAACCGTGGAGCTGCTGG + Intronic
1062074100 9:134575125-134575147 CAGGGAAACCATGGAGGTGCTGG + Intergenic
1062174781 9:135155264-135155286 CAGAGGAACAATATGGATGCAGG + Intergenic
1187765951 X:22642314-22642336 TAGAGGAACAATGGGGATGGGGG - Intergenic
1188177185 X:27005515-27005537 CACAGTAAACATAGGGATGAAGG + Intergenic
1189739671 X:44105045-44105067 CAGAGTGACAGTGGGGAGGCAGG - Intergenic
1190394346 X:49965155-49965177 CAGAGTAACAAAGGGGCTGAAGG + Intronic
1190912499 X:54786138-54786160 CAGAGTGACCATGTGGATGATGG - Intronic
1190918460 X:54827270-54827292 CAGAGTGACCATGTGGATGATGG + Intergenic
1192682614 X:73267561-73267583 CTGATTAACCATGGTGCTGCAGG - Intergenic
1193324477 X:80163657-80163679 TACAGTAAACATGGGGGTGCAGG - Intergenic
1195139797 X:101947833-101947855 CACAGTAACCATGGTGGTGTTGG - Intergenic
1197992281 X:132331077-132331099 CAGAGTAACCATGGGGGCTCAGG + Intergenic
1200230011 X:154439162-154439184 CAGAGAAATCATGGGGTGGCAGG + Intronic