ID: 1007957849

View in Genome Browser
Species Human (GRCh38)
Location 6:45933464-45933486
Sequence CTGCAGTTACAACTGATGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007957849 Original CRISPR CTGCAGTTACAACTGATGAA GGG Intronic
907551058 1:55305055-55305077 CTGAGGTTACAAGTGATGATAGG + Intergenic
910612984 1:89165147-89165169 CTGAAGTTCCAACGTATGAAAGG - Intronic
911270557 1:95796990-95797012 CTGCATTTCCAACTGAGGTATGG + Intergenic
913347990 1:117827136-117827158 CCTCAGTTACAACATATGAAGGG + Intergenic
913439488 1:118882886-118882908 ATGCAGTTACTACTTATAAAAGG + Intergenic
915897161 1:159821179-159821201 CTGCTGTGACAACTGAGGACTGG - Intergenic
917739601 1:177949797-177949819 CTTCAGTTCCATGTGATGAATGG - Intronic
917924501 1:179778024-179778046 ATGCATTTTCAACTGATGACAGG - Intronic
919828141 1:201518650-201518672 CTGAAAAAACAACTGATGAAAGG + Intergenic
920104777 1:203544504-203544526 CTGCAGTGACCACTGCTGCAAGG + Intergenic
922008902 1:221561160-221561182 ATGGAGTTAAAACTGGTGAATGG + Intergenic
923488066 1:234455327-234455349 CTGCAGGTACATCTGCAGAATGG - Intronic
1065368825 10:24960930-24960952 CTACAGTCCCAACTGAGGAAGGG - Intergenic
1066061957 10:31731906-31731928 CTCCAGTCACAGCTGATGACAGG - Intergenic
1068368366 10:56082084-56082106 ATGCAGTTAAAATTTATGAAAGG + Intergenic
1068401061 10:56528422-56528444 ATGCAATAACAAATGATGAAGGG + Intergenic
1070503530 10:77093488-77093510 ATGCAGTTAGAATTGATGGATGG + Intronic
1071005629 10:80881548-80881570 CTGCATTTCCAACTGAGGTACGG + Intergenic
1072185426 10:93033284-93033306 CTGTAGTAACTACTGATGATTGG + Intronic
1074919852 10:117996627-117996649 CTGCAATTCCAAGTGAAGAATGG + Intergenic
1076562282 10:131375086-131375108 CTGCACTGACAACTGTGGAAGGG - Intergenic
1077530515 11:3092698-3092720 CTGCAGTAAGGACTGATGATGGG + Intronic
1077922195 11:6650013-6650035 CTCCATTTTCACCTGATGAAAGG + Intronic
1078066869 11:8084469-8084491 CTCCACTTACAACTTATAAAAGG - Intronic
1080846279 11:36029893-36029915 CAGCAGGAACAACTGATGGATGG - Intronic
1085222548 11:74887518-74887540 CTGCATTTCCAACTGAGGTACGG + Intronic
1089237654 11:117046057-117046079 CTGCACTTACCACCAATGAATGG - Intronic
1093281112 12:17197426-17197448 CTGCAGGTACCACTGAAGAATGG - Intergenic
1098638570 12:72813602-72813624 CTGCATTTCCAACTGAGGTATGG - Intergenic
1100113422 12:91272930-91272952 CTGAATTTACATGTGATGAAAGG + Intergenic
1100906026 12:99300262-99300284 CTACAGATACATCTAATGAATGG + Intronic
1103201435 12:119091180-119091202 CTGCAGTTCTAGCTGATGACAGG + Intronic
1105310402 13:19203122-19203144 ATGGATTTACAACTGATGACAGG + Intergenic
1105360110 13:19704460-19704482 GTGGATTTACAACTGATGACAGG + Intronic
1106537079 13:30655393-30655415 CTGAAGTGACAACTAAGGAAAGG + Intronic
1108312616 13:49210867-49210889 CTGCTGATAGAACTGAGGAAGGG - Intergenic
1110609491 13:77473320-77473342 CTGCAGTGAGTGCTGATGAATGG - Intergenic
1112970173 13:105252203-105252225 ATGCAGTGAAGACTGATGAAAGG + Intergenic
1115477026 14:33825587-33825609 CTGCATTTCCAACTGAGGTATGG + Intergenic
1118423200 14:65631088-65631110 CTGCAGACACCTCTGATGAATGG - Intronic
1120478973 14:85024385-85024407 CTGCATTTCCAACTGAGGTACGG - Intergenic
1121298815 14:92852906-92852928 CTGCATTTCCAACTGAGGACCGG + Intergenic
1126621379 15:50643365-50643387 CTGCAGTTACAACTGGAGCCTGG - Exonic
1126855365 15:52833863-52833885 CAGCAGTTACCACTGAGGAGGGG - Intergenic
1127165528 15:56242889-56242911 CTGCACTCACAATTGAGGAAGGG + Intronic
1129809607 15:78498163-78498185 TTGCAGTTACCAGTTATGAAAGG - Exonic
1137851764 16:51752605-51752627 AAGCAGTTACAATTGATGAGTGG - Intergenic
1137931858 16:52596258-52596280 CTTCAATTACAACTGAAAAAAGG - Intergenic
1138874111 16:60928444-60928466 CTGCAGTGACAACTGTGCAAGGG - Intergenic
1149555081 17:57567823-57567845 CTACAGTTACAACAGATTATGGG + Intronic
1149760342 17:59223212-59223234 CCGCATTTACAAATAATGAATGG - Intronic
1149936524 17:60812246-60812268 CTGCAATTTAAACTGACGAAAGG + Intronic
1150865842 17:68849329-68849351 CATTTGTTACAACTGATGAACGG - Intergenic
1153228746 18:2917446-2917468 CTGCAGTGCCAACTGTGGAAGGG + Exonic
1153463489 18:5363304-5363326 CTTCAGTGACATCTGATAAAGGG + Intergenic
1153673279 18:7432838-7432860 ATGGAGTACCAACTGATGAAGGG - Intergenic
1153873047 18:9338411-9338433 CTGCAGTAACTACTCATGGATGG - Intronic
1154019447 18:10650092-10650114 CTGCATTTCCAACTGAGGTACGG + Intergenic
1155944294 18:31830440-31830462 CTGCTGTTACAACTTGTCAATGG - Exonic
1156021715 18:32606825-32606847 AGGCAGTTAAAAATGATGAAAGG - Intergenic
1156515259 18:37673888-37673910 CTGGATTTAGAACAGATGAAAGG + Intergenic
1157119815 18:44898481-44898503 CTGCAGGTAAATCTGATGGAGGG + Intronic
1157965878 18:52207537-52207559 CTGCAAGTACAACTGATAAGAGG - Intergenic
1159762869 18:72450264-72450286 CTGAGGTTACAACTAATGAATGG + Intergenic
1167221134 19:48198957-48198979 CTGTTGTCGCAACTGATGAAGGG + Intronic
1168073749 19:53967256-53967278 CTGCTGTTTCATCTTATGAATGG - Intronic
1168677417 19:58288850-58288872 CAGCAGTGACAACCGATGAAAGG - Intronic
926005614 2:9371550-9371572 CTGCAGATAAATCTGTTGAAGGG + Intronic
926034367 2:9623862-9623884 ATGCAGTGAAAATTGATGAACGG - Intronic
926387355 2:12349838-12349860 ATGCAGGGACAACTGAGGAATGG + Intergenic
927945646 2:27133693-27133715 CTGCAGCTAGAGCTGATTAATGG - Exonic
929629375 2:43443795-43443817 ATGCAGGCACAACTGATGAGAGG + Intronic
930411852 2:51033705-51033727 CTGAGGTTACAACTAATAAATGG - Intergenic
932200873 2:69827564-69827586 CTGAATTTACATCTGAAGAAGGG - Intergenic
939621807 2:144429565-144429587 CGGCAGTTACATCTTAGGAAGGG - Intronic
940023544 2:149181137-149181159 CTGGAGTTCCAACAGATGAAGGG - Intronic
941616072 2:167721295-167721317 ATGCAGTTAAAGCTGAGGAAAGG + Intergenic
942790783 2:179758007-179758029 CTGCATTTCCAACTGAGGTACGG - Intronic
942893531 2:181020997-181021019 ATGCATTTGAAACTGATGAAAGG + Intronic
946455160 2:219819556-219819578 CTGCATTTCCAACTGAGGTATGG - Intergenic
948118208 2:235509599-235509621 CTGTAGCTACAACTGAGGTATGG + Intronic
948198287 2:236111391-236111413 CTGTAGTTGCAACTGCTCAAGGG + Intronic
1168865725 20:1084844-1084866 CTGTGGTTTCAACTGATGAAGGG - Intergenic
1170133808 20:13052151-13052173 CTGCATTTCCAACTGAGGTACGG + Intronic
1170204136 20:13780023-13780045 TTGCTGTAATAACTGATGAATGG + Intronic
1170350976 20:15440634-15440656 CAGCATTTAAAGCTGATGAAGGG - Intronic
1170450891 20:16482591-16482613 CTGGTGTTAGAACTGAAGAATGG - Intronic
1171487955 20:25497427-25497449 CTGCAGATAGAACTGGAGAAAGG - Intronic
1172455496 20:35069249-35069271 CTGCTGTTACTACTGCTTAATGG - Intronic
1178220635 21:30654277-30654299 CTATGGTTACAACAGATGAATGG + Intergenic
1179051717 21:37894034-37894056 CTGAAGTTATAAGTGATGGAGGG - Intronic
1180909006 22:19435469-19435491 CTGCAGCTGCAACTGATGCTTGG - Intronic
1185267568 22:49912281-49912303 CTGCAGCTTCAGCTGGTGAACGG - Intronic
953425437 3:42793240-42793262 ATGCAGTTAAAACAGATGAAAGG - Intronic
955048789 3:55388819-55388841 CTGCATTTCCAACTGAGGACCGG + Intergenic
956800443 3:72753135-72753157 CTGATGTGACAACTGAAGAAAGG + Intronic
957527301 3:81393517-81393539 CTGCAGTTACACATTATAAATGG + Intergenic
959892006 3:111567517-111567539 TTACAGTTACAGCAGATGAATGG + Exonic
960626739 3:119688501-119688523 CTCCAATTACAACAAATGAAAGG + Intergenic
960723487 3:120647514-120647536 TTGCAGTTACTAATGATAAATGG + Intronic
966925780 3:184643776-184643798 CTTCACTTACAAATGAGGAACGG + Intronic
970740961 4:19237112-19237134 CTCCAGCAACAACTGAAGAATGG + Intergenic
971609611 4:28706123-28706145 CTACAGCTACAACTGTTGAATGG + Intergenic
973626132 4:52774195-52774217 CTGCATTTCCAACTGAGGTAGGG - Intergenic
974978241 4:68918793-68918815 CAGCAGTTATAAATGCTGAATGG + Intergenic
975165616 4:71175288-71175310 CTGCATTTCCAACTGAGGTACGG + Intergenic
976024996 4:80676077-80676099 CTGCATTTCCAACTGAGGTATGG - Intronic
976827421 4:89276389-89276411 GTGCAGTATCAACTAATGAAAGG - Intronic
976978020 4:91187191-91187213 CTGCATTTCCAACTGAGGTACGG - Intronic
978515238 4:109561409-109561431 CTTCAGTTTCAATTGATGCAGGG + Intronic
978789434 4:112645431-112645453 CTCGAGTTACACATGATGAATGG - Intronic
980258250 4:130410982-130411004 CTGCAGTGACAAAATATGAATGG - Intergenic
981284546 4:143000577-143000599 ATGCAGTTATAAATGATGAGTGG - Intergenic
982487527 4:155984965-155984987 GTGCAGTGAAAACTGTTGAATGG - Intergenic
983301843 4:165935624-165935646 TTGCAGTTACATTTGAAGAATGG - Intronic
983879354 4:172915540-172915562 ATGCAGTAAAAAATGATGAAGGG + Intronic
987639316 5:20591883-20591905 CTGCTGTTAAAACCTATGAATGG + Intergenic
988314233 5:29603118-29603140 CTGCATTTCCAACTGAGGTATGG + Intergenic
989165059 5:38425628-38425650 CTGCAGTAAGAAGTGCTGAAAGG - Intronic
989429646 5:41337705-41337727 CTGCAGTTGTCACTGATTAAAGG - Intronic
990541672 5:56779159-56779181 CTGCAATAAAAAATGATGAAGGG - Intergenic
994002369 5:94795222-94795244 CTTTGCTTACAACTGATGAAGGG + Intronic
994111074 5:96005075-96005097 CTGCCCTCACAACTGATTAATGG - Intergenic
995284901 5:110376943-110376965 CTGCTGTCACAAATGATTAATGG - Intronic
997993342 5:138564673-138564695 ATGCAGTTACAATTTAAGAAGGG - Intronic
998696521 5:144646812-144646834 CTGCAGTGGCAGCTGAAGAATGG - Intergenic
999279019 5:150352572-150352594 CTGTTGTTACAATGGATGAAGGG + Intergenic
1000080069 5:157836833-157836855 CTGCAGTTAAGAATGATGAGTGG - Intronic
1002957071 6:1876637-1876659 CTATTGTGACAACTGATGAAAGG + Intronic
1003470363 6:6424160-6424182 CTGAAGTTACAACATCTGAAAGG + Intergenic
1003781708 6:9435501-9435523 CTCCAGTTACAGCTGATTAAAGG - Intergenic
1004121173 6:12823676-12823698 CTGAAGCTCCAACTGATAAAGGG - Intronic
1006793265 6:36717181-36717203 CTGCAGTGAAAACTGAGGAGTGG + Intronic
1007455913 6:41976978-41977000 CTGCTGCTACAACTGTTGTACGG - Intronic
1007957849 6:45933464-45933486 CTGCAGTTACAACTGATGAAGGG + Intronic
1013067078 6:106694366-106694388 CTGCAGTTACAGCTGAGAGAAGG - Intergenic
1013218974 6:108059495-108059517 CTGCAGTTATTATTCATGAAAGG - Intronic
1019049015 6:169169237-169169259 CTGCAGTTTCATGTCATGAATGG + Intergenic
1020223658 7:6262080-6262102 CAGCAATTACAGCTGAAGAAAGG + Intronic
1022196424 7:28071666-28071688 CGGCACTTACAGCTGATTAAAGG + Intronic
1023174204 7:37419960-37419982 CAGCAATTACAAATGATGATAGG - Intronic
1025974343 7:66357756-66357778 TTCAAGTTACAACTGATCAAAGG - Intronic
1026330632 7:69349510-69349532 CTGCAGTTGTAACTGATAAGTGG - Intergenic
1034307200 7:150053813-150053835 CTGCAGTTACAAATAAAGGAAGG + Intergenic
1034799647 7:154046870-154046892 CTGCAGTTACAAATAAAGGAAGG - Intronic
1035118509 7:156545249-156545271 CTGCAGCTCCACCTGCTGAAGGG - Intergenic
1035547648 8:495978-496000 CTCCAGTCACAACTGTTGGAGGG - Intronic
1039944653 8:42119011-42119033 CTGCAGGTACAACGGATCTAAGG - Intergenic
1044230528 8:89771914-89771936 ATGCATTCACAACTGATAAATGG - Intronic
1044392255 8:91665062-91665084 CTGCAGATACAACTGATGTGGGG + Intergenic
1044521329 8:93202546-93202568 ATGCAATTAAAAATGATGAAGGG - Intergenic
1046913071 8:119650087-119650109 CAGCATTACCAACTGATGAATGG + Intronic
1048760914 8:137794283-137794305 CTTCATTTAAAACTGCTGAATGG - Intergenic
1049080019 8:140435316-140435338 CTGCAGTTTGAGCTAATGAAGGG - Intronic
1051652550 9:19343421-19343443 CTGCAGCCACCACTAATGAAGGG - Intronic
1051804862 9:20981217-20981239 CTGCAGTTACTTCTGATCCAGGG - Intronic
1051913055 9:22177108-22177130 CTGCATTTACAACTGAGGTATGG + Intergenic
1051918844 9:22239723-22239745 CTTCATTTACAAATGAGGAAAGG - Intergenic
1055516644 9:77040658-77040680 ATGCAGGTACCACTGAAGAAGGG + Intergenic
1055770508 9:79711739-79711761 CGAAAGTTAAAACTGATGAAGGG - Intronic
1057326043 9:94065131-94065153 TGGCACTTACAACTAATGAAAGG - Intronic
1057464869 9:95303783-95303805 CTTCAGCTTCAACTTATGAATGG + Intronic
1058148091 9:101433706-101433728 CTGGAGTTACCTCTGAAGAATGG + Intronic
1062409473 9:136415591-136415613 TTGTGGTCACAACTGATGAAAGG + Intronic
1186617580 X:11205357-11205379 TTGCTGTTACAACTGGAGAAGGG - Intronic
1187018801 X:15358177-15358199 CTGCAGTTATAGATGAAGAATGG - Exonic
1187677619 X:21733348-21733370 CTTCAGTTCCTAATGATGAATGG + Intronic
1187680619 X:21764019-21764041 CTGCAGTTATAATTGATTCAAGG - Intergenic
1189042791 X:37560588-37560610 CTGCATTTCCAACTGAGGTACGG + Intronic
1189295846 X:39917035-39917057 CTGCTGATACAACCTATGAAGGG - Intergenic
1190979796 X:55446545-55446567 ATGCAGTAAAAAATGATGAAGGG + Intergenic
1195481141 X:105346872-105346894 CTCCAGGTAGAACTGTTGAAAGG + Intronic
1197599737 X:128514699-128514721 GTGCAGTTACAAATGATACAAGG - Intergenic
1197742433 X:129905655-129905677 CTGCAATTACAAGGGATCAAAGG + Intergenic
1198095678 X:133377530-133377552 TTGAAGTTCCAACTGATGGATGG - Intronic
1199484310 X:148331508-148331530 CTGCATTTCCAACTGAGGTACGG - Intergenic
1201494331 Y:14576621-14576643 CTGCATTTCCAACTGAGGTACGG - Intronic
1201599525 Y:15713073-15713095 CTGCATTTCCAACTGAGGTATGG + Intergenic