ID: 1007963449

View in Genome Browser
Species Human (GRCh38)
Location 6:45982228-45982250
Sequence CAAACTGATAAGATGGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007963449_1007963459 14 Left 1007963449 6:45982228-45982250 CCTGACTCCATCTTATCAGTTTG 0: 1
1: 0
2: 0
3: 12
4: 133
Right 1007963459 6:45982265-45982287 TGTCCTTGCTGCTCCTGCTTGGG 0: 1
1: 0
2: 1
3: 47
4: 364
1007963449_1007963458 13 Left 1007963449 6:45982228-45982250 CCTGACTCCATCTTATCAGTTTG 0: 1
1: 0
2: 0
3: 12
4: 133
Right 1007963458 6:45982264-45982286 CTGTCCTTGCTGCTCCTGCTTGG 0: 1
1: 0
2: 4
3: 48
4: 358

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007963449 Original CRISPR CAAACTGATAAGATGGAGTC AGG (reversed) Intronic
904302508 1:29563541-29563563 CCATCTGATCAGGTGGAGTCTGG + Intergenic
909353261 1:74678235-74678257 CAAACTGATCAGTTGGAATAGGG + Intergenic
910345134 1:86227955-86227977 CAAACTGAAAAGCTGGGGTGGGG - Intergenic
910998294 1:93132820-93132842 CAAGCTAATAAAATGGAGTGAGG - Intronic
911531416 1:99047638-99047660 CAAACTGAGAAGAAGGAACCTGG - Intergenic
911784458 1:101928421-101928443 CAAGTAGATAAGAAGGAGTCAGG - Intronic
917880304 1:179329158-179329180 CAAACTGATGAGTAAGAGTCAGG + Intronic
917991342 1:180382482-180382504 CAAACTGCCAAGATTGAATCTGG + Intronic
919341131 1:196308336-196308358 GACACTGAAAAGATAGAGTCAGG - Intronic
919675425 1:200377559-200377581 CAAACTGGTAAAATGGATTGTGG - Intergenic
924682874 1:246255862-246255884 CAATCTCTTAAGATTGAGTCAGG - Intronic
1063275663 10:4564893-4564915 CAAACTGTTGGGATGGTGTCTGG + Intergenic
1067972368 10:50987330-50987352 GAAAGAGTTAAGATGGAGTCTGG - Intergenic
1071137660 10:82470597-82470619 AAAGCTGATAAGCTGGAGGCAGG + Intronic
1073784615 10:106875136-106875158 CAGAGTGATAAAATGGACTCTGG - Intronic
1074321053 10:112402771-112402793 CAAACTGCTAAGAGGAATTCAGG - Intronic
1074748729 10:116562419-116562441 AAAACGGACAAGATGGAGCCTGG + Intronic
1075526481 10:123191309-123191331 AGAACTGCCAAGATGGAGTCCGG + Intergenic
1076579356 10:131496317-131496339 CAAACAGCAAGGATGGAGTCAGG + Intergenic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1078863337 11:15273997-15274019 CAAGCTAATAAGTTGTAGTCAGG + Intergenic
1079975999 11:27092344-27092366 CAAACGGATCAGCTAGAGTCAGG + Intronic
1083482457 11:62958371-62958393 CACACTGATAAGGTGAAGTGTGG + Intronic
1086593841 11:88547619-88547641 CAGTCTGAAAAGATGGAATCAGG - Intronic
1088410475 11:109528708-109528730 AAAAATGATAAAATGGATTCTGG + Intergenic
1088580630 11:111312344-111312366 ATAACTGAAATGATGGAGTCAGG + Intergenic
1089195502 11:116692087-116692109 GAAAAGGATGAGATGGAGTCAGG - Intergenic
1090763860 11:129860131-129860153 CAAACTGATAAAAGTGAGTTAGG + Intergenic
1091855779 12:3738109-3738131 AAAACTGATCAGATGGAGATTGG - Intronic
1093140998 12:15510188-15510210 TAAATTGATAAGATGAATTCAGG + Intronic
1096230384 12:49893479-49893501 AAAACTGATAAGTTGCAGGCTGG - Intronic
1097941366 12:65310067-65310089 CAACCTGATTAGAAGGAGTAAGG + Intronic
1100606681 12:96157680-96157702 AGAGCTGCTAAGATGGAGTCGGG - Intergenic
1101273386 12:103172325-103172347 CTAAGTGACAAGATGGTGTCAGG + Intergenic
1102648389 12:114418652-114418674 CAGAGTGATAAGATGGAGAGAGG - Intergenic
1104575752 12:129964585-129964607 CACACTGATAAGATGGGGAGTGG + Intergenic
1104577022 12:129976035-129976057 CAAATTGATATGATGGACTTTGG + Intergenic
1105839077 13:24237785-24237807 AAAATTTATAAGATGGGGTCTGG - Intronic
1106602902 13:31202322-31202344 CAGAATGAGAAGATTGAGTCAGG + Intronic
1110997624 13:82133217-82133239 CAATCTGCTAAGATGGAATCAGG - Intergenic
1111960068 13:94800474-94800496 CAAAGTGGTAAGAGGTAGTCAGG - Intergenic
1114151365 14:20043425-20043447 GAAATTGATAAGATGGAATATGG - Intergenic
1115906846 14:38210494-38210516 CAACCTGAGAACCTGGAGTCCGG + Exonic
1115926596 14:38442464-38442486 CAAACATAGAACATGGAGTCAGG + Intergenic
1119772236 14:77227435-77227457 CAAAATGATGAGATGTAGTCAGG + Intronic
1120699265 14:87680427-87680449 GAAACTGATAATATAGAATCAGG - Intergenic
1121022151 14:90586831-90586853 AGAACTGATGAGTTGGAGTCAGG - Intronic
1121717892 14:96089216-96089238 CAAACTGCTAAGACGGACCCCGG - Exonic
1124579672 15:30942398-30942420 CAAACTGAACAGAGGCAGTCAGG + Exonic
1126549584 15:49912448-49912470 CAAACTTCTAAGATTGAATCAGG + Intronic
1126880341 15:53088044-53088066 CAACCTCTTAAGATGGAATCAGG - Intergenic
1127303088 15:57676921-57676943 TAAACTGCTAAGATGGATCCGGG - Intronic
1130278939 15:82503753-82503775 CCACTTGAAAAGATGGAGTCTGG - Intergenic
1131580807 15:93641176-93641198 CAAAGTGTTAACATGGATTCTGG - Intergenic
1135967677 16:27049391-27049413 CAGGCTGAGAAGCTGGAGTCAGG - Intergenic
1138141087 16:54569070-54569092 GAAACTCATAAAATAGAGTCTGG + Intergenic
1138302768 16:55946398-55946420 CAAACTGATAGAATGGAGCTGGG - Intronic
1139124324 16:64059231-64059253 CAAACTGATAGGTCTGAGTCAGG + Intergenic
1140174382 16:72641798-72641820 CAAACTAACTAAATGGAGTCAGG + Intergenic
1140951686 16:79824537-79824559 CAAACGGATGAGTAGGAGTCAGG + Intergenic
1141147946 16:81544965-81544987 GAAAATGAAAAGATTGAGTCTGG - Intronic
1141305469 16:82859260-82859282 TAAACTGATCAGATGCAGTCGGG + Intronic
1143971854 17:10801603-10801625 CTGACTCAGAAGATGGAGTCAGG - Intergenic
1146082308 17:29791498-29791520 CAAACTGACAAGATGAGTTCAGG + Intronic
1148643345 17:49204588-49204610 CAGAATGGTGAGATGGAGTCAGG + Intronic
1149546680 17:57509047-57509069 CAGACTGGGAAGATGGAGGCAGG - Intronic
1156136468 18:34045573-34045595 CAAATTGATAACATGGTGTGTGG - Intronic
1156489943 18:37490249-37490271 CAAACTGAAAACAGGGAGTACGG + Intronic
1166011830 19:39948492-39948514 CAAACAAATAAAATGGAGCCCGG - Intergenic
925255522 2:2483304-2483326 CAAACAGATACTATGGAGGCAGG - Intergenic
926172031 2:10558590-10558612 CACACTGTGAAGGTGGAGTCAGG - Intergenic
929488155 2:42373071-42373093 CGAGCTGATAAGGTGCAGTCAGG - Intronic
932009422 2:67960391-67960413 CAAACTGAGGAGATGGTGTAGGG + Intergenic
932668257 2:73715053-73715075 CAAACTGTTCAGATGTAGTTGGG - Intergenic
932729504 2:74208492-74208514 GAAGCAGATAAGCTGGAGTCAGG + Intronic
933450946 2:82450808-82450830 CAACCTAATAAGATTGAATCAGG + Intergenic
935568713 2:104636388-104636410 CAAAGTGATAAGAAGGACCCAGG - Intergenic
936622484 2:114114732-114114754 TAAACTCATAAGATGGACCCAGG + Intergenic
937007860 2:118534611-118534633 CAAACTGGAAAGTTGGAGACAGG + Intergenic
938769820 2:134491604-134491626 GACACTGATATGATGTAGTCTGG + Intronic
939635865 2:144582042-144582064 CACACTGATGAGAAGGACTCAGG - Intergenic
941687918 2:168466543-168466565 CAATCTGATTAGAAGCAGTCAGG + Intronic
942187422 2:173437720-173437742 CAATGTGATAAGATGTAGTAAGG + Intergenic
942594747 2:177582377-177582399 CAAATGGACAAAATGGAGTCGGG + Intergenic
942597302 2:177603409-177603431 CAAACTGATTACATGATGTCTGG + Intergenic
942833486 2:180264508-180264530 CAAATTGACAATATGGAGCCAGG - Intergenic
943332891 2:186581279-186581301 CAAACTGAAAAAATGGAATATGG - Intergenic
1175749414 20:61484880-61484902 CAAACAGATGAGATGGAAACAGG - Intronic
1184625090 22:45720672-45720694 CAAACTGAAAAGAGGAAGTTTGG + Intronic
952303741 3:32127139-32127161 CAAATTGATGAGATGGAGTAGGG - Intronic
952419255 3:33116659-33116681 CAAAATGTTAAGATGGTGGCCGG - Intronic
952821258 3:37487974-37487996 CAGACTGATAAAATGTAGCCAGG + Intronic
952912379 3:38201962-38201984 CAAAGGGACAAGAGGGAGTCAGG + Intronic
953562269 3:44000551-44000573 CAAGCTGATAACATGCAGACTGG + Intergenic
961048365 3:123725263-123725285 TAAACTGATAAGATGGAGCAGGG - Intronic
970550592 4:17177188-17177210 CAAACTGAGCAGAGGGAGGCAGG + Intergenic
971794494 4:31209431-31209453 GAGACTGATATGAAGGAGTCAGG + Intergenic
971897290 4:32614281-32614303 GAAACTGATAAGAGGGAGGGAGG - Intergenic
973170278 4:47134048-47134070 CAAAATGATTAGAGGGAGACTGG + Intronic
973791147 4:54379269-54379291 TAAGCTGAGAAGATGGAATCTGG - Intergenic
975447083 4:74478485-74478507 CAAAATGATGAGATGATGTCAGG + Intergenic
979420930 4:120504078-120504100 CAAATTTATAAAATGGAGTTTGG + Intergenic
980749887 4:137075079-137075101 AAAACTGATAAGACAGAGTCAGG + Intergenic
981534868 4:145788660-145788682 CAAACTGACAATATTGATTCAGG + Intronic
983428466 4:167618087-167618109 CAAACTACTAAGATTGAATCAGG - Intergenic
984430893 4:179647656-179647678 CATACTGCTATGATGGAATCTGG - Intergenic
984544556 4:181086291-181086313 AAAACTGATAAGGTTGAGGCCGG + Intergenic
984874996 4:184359648-184359670 CAAACTCACAAGATGTTGTCAGG - Intergenic
990908279 5:60826583-60826605 CAAACTGATAGGGAGGAGACAGG - Intronic
993907038 5:93634491-93634513 CAAACTGATGAGGTGGACTCAGG + Intronic
994053666 5:95391121-95391143 CAAACTGTGAAGATGAAATCAGG + Intergenic
999001661 5:147930279-147930301 CAAACTGGAAATATGGAGCCTGG - Intergenic
1003696696 6:8413117-8413139 TAAACTGATGAGTTGAAGTCTGG - Exonic
1005525492 6:26643591-26643613 TACTCTGATGAGATGGAGTCTGG + Intronic
1007572993 6:42906736-42906758 CAAGCGGATAACATGAAGTCAGG + Intergenic
1007963449 6:45982228-45982250 CAAACTGATAAGATGGAGTCAGG - Intronic
1009408341 6:63336059-63336081 CAAACTGGTAAGATTGAGTGGGG + Intergenic
1012839819 6:104316036-104316058 CAAACTTATAAGAAGTAGGCAGG + Intergenic
1013065642 6:106682501-106682523 AAAATTGTAAAGATGGAGTCTGG + Intergenic
1015335971 6:132038949-132038971 CAAACTTATAAGTTGGAAGCAGG - Intergenic
1016506458 6:144786267-144786289 CAAACAAATAAGATGCATTCAGG - Intronic
1024804205 7:53117608-53117630 GAAACTGATGGGGTGGAGTCAGG + Intergenic
1030504070 7:110397796-110397818 CAAAATCATGAGATTGAGTCAGG + Intergenic
1032581761 7:133109874-133109896 CAAACTAAAAAAATGGAGACAGG + Intergenic
1032905772 7:136363132-136363154 CAAAATGATAAAATGGACTTTGG - Intergenic
1035831200 8:2696475-2696497 GAAACTGATTAGAGGAAGTCTGG + Intergenic
1038356957 8:26838531-26838553 CAAGCTGATAAGACTGATTCAGG + Intronic
1041782597 8:61593956-61593978 CAAACTAACAAGATGGAGTGAGG + Intronic
1043168785 8:76937635-76937657 GAAACTAATAAGATGAAGACAGG + Intergenic
1045328712 8:101137010-101137032 CAAACTCATAAGATGGGGTAAGG + Intergenic
1046599753 8:116302234-116302256 TAAACTGTTAAGGTGGAGTCAGG + Intergenic
1047879873 8:129181182-129181204 CACACTGCTTAGATGGAGGCAGG + Intergenic
1048583762 8:135753382-135753404 CAAACTGCTGAGATGGTGGCTGG - Intergenic
1050159241 9:2699846-2699868 CAAACTGAGAAGGTGGAAGCTGG + Intergenic
1052137368 9:24929768-24929790 CAATGTGTTAAGATGGAGTAAGG - Intergenic
1052602395 9:30651819-30651841 CAAAGTGATAAGATGAATTCAGG + Intergenic
1058237831 9:102515078-102515100 CACACTGCTAAGCTGTAGTCTGG - Intergenic
1058776021 9:108284673-108284695 AAAACTGTTAGGATGGAGTTGGG - Intergenic
1059844757 9:118262474-118262496 CAAACTGAGAAAGTGGAGACAGG + Intergenic
1061781480 9:132999049-132999071 CCAGCTGCTAAGAAGGAGTCGGG - Intergenic
1185949700 X:4419073-4419095 AAAACTGATAACATGGATTAAGG - Intergenic
1188081174 X:25842661-25842683 CAAACTCATTATATGAAGTCAGG + Intergenic
1190396318 X:49988807-49988829 AACACTGATAATATGGAGTGTGG + Intronic
1196309414 X:114144951-114144973 CAAACACATAAGATGTTGTCTGG + Intergenic
1197592792 X:128429084-128429106 ACAAATGAGAAGATGGAGTCTGG + Intergenic
1201386414 Y:13444373-13444395 CAAACTGCCAAGATAGAATCAGG + Intronic