ID: 1007965224

View in Genome Browser
Species Human (GRCh38)
Location 6:45998286-45998308
Sequence GTGTCCTAACATCTGTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 127}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007965224_1007965229 28 Left 1007965224 6:45998286-45998308 CCAGCACACAGATGTTAGGACAC 0: 1
1: 0
2: 2
3: 10
4: 127
Right 1007965229 6:45998337-45998359 CACATGGCTTGGCAGGAGCCAGG No data
1007965224_1007965227 17 Left 1007965224 6:45998286-45998308 CCAGCACACAGATGTTAGGACAC 0: 1
1: 0
2: 2
3: 10
4: 127
Right 1007965227 6:45998326-45998348 TGTGTCAGCAGCACATGGCTTGG 0: 1
1: 0
2: 2
3: 15
4: 207
1007965224_1007965226 12 Left 1007965224 6:45998286-45998308 CCAGCACACAGATGTTAGGACAC 0: 1
1: 0
2: 2
3: 10
4: 127
Right 1007965226 6:45998321-45998343 CAGCATGTGTCAGCAGCACATGG 0: 1
1: 0
2: 3
3: 17
4: 270
1007965224_1007965228 21 Left 1007965224 6:45998286-45998308 CCAGCACACAGATGTTAGGACAC 0: 1
1: 0
2: 2
3: 10
4: 127
Right 1007965228 6:45998330-45998352 TCAGCAGCACATGGCTTGGCAGG 0: 1
1: 0
2: 1
3: 22
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007965224 Original CRISPR GTGTCCTAACATCTGTGTGC TGG (reversed) Intronic
900683143 1:3928909-3928931 GTGTCCTAAAAACTGTACGCAGG + Intergenic
902621176 1:17651914-17651936 GTGCCCCATCAGCTGTGTGCTGG + Intronic
902840215 1:19069655-19069677 GTTTCCTAACCTCTCTGTGTGGG - Intergenic
906638499 1:47426734-47426756 ATGTCATACCATATGTGTGCAGG + Intergenic
907992950 1:59600570-59600592 GTGTCCAAAGAGCTGGGTGCAGG - Intronic
910295488 1:85640527-85640549 GTGGCCTAACATATCTGTTCTGG - Intergenic
916724442 1:167510292-167510314 GTGTCCTGACATGCATGTGCAGG - Intronic
919802403 1:201361651-201361673 CTGTCCTGACACCCGTGTGCAGG + Intronic
923147700 1:231209630-231209652 GTGTCCTCACAGCTGTGACCAGG + Intronic
923447892 1:234089501-234089523 GTGTCTTCACATCAGTGTTCAGG + Intronic
1065546290 10:26825012-26825034 GAGTCCTAATATTTGTGTGCTGG + Intronic
1068119526 10:52771712-52771734 CTGTCCTACAATCTGGGTGCAGG + Intergenic
1072187790 10:93059151-93059173 CTGTGGTAACTTCTGTGTGCAGG - Exonic
1072803766 10:98411091-98411113 CTGTTCCAACATCTGAGTGCGGG - Intronic
1073379239 10:103065566-103065588 GTGACCTGGCATCTGTCTGCAGG + Intronic
1074190010 10:111127484-111127506 GGGTACTAAGATCTGTGTTCTGG - Intergenic
1074540499 10:114361562-114361584 GTGTCCTAGCCTCTCTGTTCAGG - Intronic
1076743207 10:132498295-132498317 GTGTCCTTACCTCTGCCTGCAGG - Intergenic
1076768370 10:132650010-132650032 GTGCCCCAACCTGTGTGTGCTGG + Intronic
1085041534 11:73329229-73329251 GTGTGCTACCATCTGTGTGCAGG - Intronic
1087904345 11:103678233-103678255 ATGACCTAACATCTTTGTTCGGG + Intergenic
1090038093 11:123265899-123265921 GTGTTGTAAAATTTGTGTGCAGG + Intergenic
1091519586 12:1223654-1223676 GTTTGCTTACATCTGTGTGCTGG + Intronic
1092908784 12:13126596-13126618 CTGCCATAACATCTGTGTGCAGG + Intronic
1096545234 12:52334256-52334278 TGTTCCTAACATCTGTGTTCAGG - Intergenic
1099645576 12:85350448-85350470 GTCTCCTGCCATTTGTGTGCTGG + Intergenic
1099717312 12:86311887-86311909 CTCTCCTAACACCTGTGTCCAGG - Intronic
1104346963 12:128009030-128009052 CTGTGCAAGCATCTGTGTGCTGG - Intergenic
1106455807 13:29925579-29925601 GAGTCATATCATCTGTGAGCTGG + Intergenic
1107028945 13:35831365-35831387 GTCTCCTAACACCTGTTTTCAGG - Intronic
1107764836 13:43723112-43723134 GGGGCCTAAGATCTGTGTTCAGG - Intronic
1111784599 13:92770999-92771021 GTGTCCTTACCTCTGGGTGGTGG + Intronic
1112715243 13:102177378-102177400 GTGTCCTTTAAACTGTGTGCTGG + Intronic
1113352610 13:109544247-109544269 GAGTGCTAACATGTGTGTTCAGG + Intergenic
1114696484 14:24631595-24631617 GTTTCCTAATATCTGTGACCTGG + Intronic
1117446501 14:55808297-55808319 TTGGCCAAACATCTTTGTGCAGG - Intergenic
1117702236 14:58425636-58425658 GTGACCTAAGATCTGAGTGTAGG - Intronic
1120136682 14:80878155-80878177 GTGTCATGTCACCTGTGTGCTGG - Intronic
1121834949 14:97083725-97083747 AGGTGCTAACATCTGTGTACAGG + Intergenic
1122859045 14:104574057-104574079 ATGTCCCAGCAGCTGTGTGCAGG + Intronic
1124391202 15:29259499-29259521 GTGTCCCAGCATCTGTGGGAGGG + Intronic
1125891615 15:43270862-43270884 GTGTCCTCACTTCTCTGTTCAGG - Intergenic
1130057267 15:80537296-80537318 GTGTTCTAAGTTCTGTGTTCAGG - Intronic
1131273400 15:90960476-90960498 GTGTCACCACAGCTGTGTGCCGG - Exonic
1132744088 16:1429561-1429583 GTGTCCAAATCTCTGTGTGTTGG + Intergenic
1132877832 16:2148289-2148311 GTGTCCTGAGATGTGGGTGCTGG - Intronic
1140222148 16:73051475-73051497 GAATCAAAACATCTGTGTGCAGG - Intronic
1140305910 16:73802493-73802515 GTGTCCTATCATCAGTGTCTGGG - Intergenic
1140632038 16:76864878-76864900 CTGGGCTAACATCTATGTGCTGG + Intergenic
1142289882 16:89188867-89188889 GTGTGCTGGCATCTGTGTGTGGG - Intronic
1142289905 16:89189020-89189042 GTGTGCCAACATCTGTGTGTGGG - Intronic
1142289935 16:89189224-89189246 GTGTGCCAGCATCTGTGTGTGGG - Intronic
1143380784 17:6495034-6495056 GTGTGCTCCCATCTGTGTGAGGG + Intronic
1147451091 17:40504659-40504681 ATATCCTAACATCTGAATGCAGG - Intergenic
1148293281 17:46476122-46476144 TTGTTTTAACATCTGTGTTCAGG + Intergenic
1148315468 17:46693825-46693847 TTGTTTTAACATCTGTGTTCAGG + Exonic
1150131184 17:62670100-62670122 GAGGCCTTACATCTGTCTGCAGG - Intronic
1152191885 17:78893137-78893159 GTGTGCGTACATGTGTGTGCAGG + Intronic
1152191888 17:78893165-78893187 GTGTGCATACATGTGTGTGCAGG + Intronic
1152509817 17:80778939-80778961 GGAACCAAACATCTGTGTGCTGG + Intronic
1153904527 18:9649649-9649671 GTGTTCTAACAAATGTGTCCTGG - Intergenic
1154339851 18:13493883-13493905 GCTTCCTCCCATCTGTGTGCGGG + Intronic
1159371132 18:67528849-67528871 GTGGCTTAACATATGTGTGCTGG - Intergenic
1162917487 19:13882178-13882200 GTGTGCCCACATCTGTGTGCAGG - Intergenic
1164206935 19:23067022-23067044 GTGTCACATCATCTGGGTGCTGG + Intergenic
1164312763 19:24060577-24060599 GAGTCATAACATCTAGGTGCTGG - Intronic
1165708767 19:37994941-37994963 GTGTTCAACCCTCTGTGTGCAGG + Intronic
1168258734 19:55181054-55181076 GTGTCCAGACGTCTGTGTCCAGG - Intergenic
927362112 2:22248247-22248269 ATGTCCTAATATCTGCATGCAGG + Intergenic
929589269 2:43134594-43134616 GTGTGCCAACATGCGTGTGCAGG + Intergenic
937383981 2:121409036-121409058 GTCTCCTAACAGCTGTAGGCAGG + Intronic
937463033 2:122105653-122105675 GTGTGTTAACATCTGTGTAGAGG - Intergenic
938248925 2:129798828-129798850 ATCTCCTAGGATCTGTGTGCAGG - Intergenic
938867000 2:135433049-135433071 GTGGCCTAACCTATGTATGCTGG + Intronic
939638862 2:144614938-144614960 CTGGCCTAACATCTTTATGCAGG + Intergenic
941111094 2:161419038-161419060 GTCTCCTTACATCCGTGTTCTGG - Exonic
942807179 2:179945626-179945648 GTTTCCTATCATTTGTTTGCTGG + Exonic
946716006 2:222556113-222556135 GTGGCGTATCATCTGAGTGCAGG + Intronic
947155804 2:227162075-227162097 GTGACCTAACCTCTCTGGGCTGG - Intronic
947474887 2:230435657-230435679 TTGTCTTAACACCTGTGTGATGG - Intronic
1172999192 20:39093327-39093349 GAGGCCCAACATCTGTGTCCAGG + Intergenic
1175797544 20:61781637-61781659 GTGGCCTAACATCTGTGTGATGG + Intronic
1180842617 22:18966325-18966347 GTGTCCTTTCATCTCTGTTCAGG + Intergenic
1180999988 22:19983513-19983535 CTGTCCTAACATGTTGGTGCAGG - Intronic
1203237221 22_KI270732v1_random:16909-16931 ATGTCCTAACATATTTGTGTTGG - Intergenic
949340892 3:3029733-3029755 GACTCCTAACCTCTTTGTGCTGG + Intronic
953296278 3:41720892-41720914 GTGTCATATCATATGTGTACAGG - Intronic
953508730 3:43513106-43513128 GTTTCCTCACATACGTGTGCTGG - Intronic
955952174 3:64253379-64253401 GTGTCTGAACAGCTGTGTGATGG - Intronic
958640048 3:96794547-96794569 GTGTCCTGAGAAGTGTGTGCTGG + Intergenic
962855657 3:139342597-139342619 GTGTCCAATCAGCTGTGTCCAGG + Intronic
963864124 3:150341949-150341971 CAGTACTAACATCTGTGTGAAGG - Intergenic
969724573 4:8911618-8911640 CTCTCCTAGCATCTGCGTGCTGG + Intergenic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
974792520 4:66710915-66710937 GTTTCCTAACTTCTGTGAGATGG + Intergenic
975781027 4:77839918-77839940 GTGTCATAACATCTGAGTTTGGG + Intergenic
992932925 5:81669365-81669387 GTTGCCAAACATCTGTGTGCAGG - Intronic
995272291 5:110235510-110235532 GTTTCCTAACATAGGGGTGCAGG - Intergenic
998523757 5:142824185-142824207 GTGTCTTAACAGCTGTGTCCTGG + Intronic
1001943592 5:175758744-175758766 GTTTCCTAACTTATGTTTGCTGG + Intergenic
1002279757 5:178123391-178123413 GTGAGCTGACATCAGTGTGCAGG - Exonic
1007965224 6:45998286-45998308 GTGTCCTAACATCTGTGTGCTGG - Intronic
1008844143 6:55940945-55940967 GTGTCCTAACATCTTCCTACAGG - Intergenic
1013768149 6:113597082-113597104 TTATGCTAACATCTGTGTGAGGG - Intergenic
1016756494 6:147693351-147693373 GCGTCCTGACAGCTGCGTGCAGG - Intronic
1016839283 6:148509767-148509789 GAGTACAAACATTTGTGTGCCGG - Intronic
1018141997 6:160847249-160847271 GTGTACTATCATCTGTTTTCTGG - Intergenic
1018709287 6:166486239-166486261 GTGTGCTCACAGCTGTGTGTGGG - Intronic
1018855002 6:167668930-167668952 GTGTGCTGACCTCTGTGTGGAGG - Intergenic
1019635396 7:2072867-2072889 GTGCGCTCACATCTGTGTGGGGG + Intronic
1021703393 7:23342370-23342392 GTATTTTAAAATCTGTGTGCTGG + Intronic
1023522928 7:41066933-41066955 GTATCATAACATCTGTGTTTAGG - Intergenic
1024777778 7:52807966-52807988 GTTTCCTAACCTCTTTGTTCTGG + Intergenic
1025161846 7:56668229-56668251 GAGTCCTATCACCTGGGTGCTGG + Intergenic
1025171467 7:56761181-56761203 GTGTCCTCACATCTCTGACCTGG - Intergenic
1025224011 7:57141152-57141174 GAGTCCTATCACCTGGGTGCTGG + Intergenic
1025700398 7:63814301-63814323 GTGTCCTCACATCTCTGACCTGG + Intergenic
1025784521 7:64632483-64632505 GTATCATATCATCTGTGTGTTGG - Intergenic
1028654316 7:93185829-93185851 GTGTTCTAAAGTGTGTGTGCTGG + Intergenic
1033477245 7:141702405-141702427 GCGTCCATACACCTGTGTGCGGG + Intergenic
1033999545 7:147395248-147395270 GTGTCCTAATCTCTGAGGGCTGG + Intronic
1035037949 7:155907601-155907623 GTGTCCTGACGTGTGTGTGCTGG + Intergenic
1035664163 8:1368204-1368226 GTGTCCATATATCTGTGTGCAGG + Intergenic
1035884879 8:3281070-3281092 GCCTCTAAACATCTGTGTGCAGG - Intronic
1036752270 8:11450869-11450891 GTGTCCAGACATAGGTGTGCAGG + Intronic
1040385155 8:46910126-46910148 GTGTCCTGAGCTCTGTGTGTAGG - Intergenic
1041976400 8:63803796-63803818 GTGTCCTTACCTCTGTGTTTAGG - Intergenic
1042365431 8:67930961-67930983 GTGGCCTTACATTTGTGTGAAGG + Intergenic
1043823639 8:84898870-84898892 GTGTCCTAACAGAGGTTTGCAGG - Intronic
1048355756 8:133652916-133652938 GTGTCCATGCATGTGTGTGCAGG + Intergenic
1051898140 9:22009445-22009467 GCGTCCTAGCATCTTTGGGCAGG - Intronic
1052762258 9:32604616-32604638 GTGGCCAAACACCTGTGTTCCGG + Intergenic
1060036375 9:120259540-120259562 CAGTCCTAACATCTGTGAGATGG + Intergenic
1061019348 9:128004105-128004127 GTGTCCTAGCAGCTGTCAGCAGG + Intergenic
1062253929 9:135612313-135612335 CTGGCCTGAGATCTGTGTGCAGG - Intergenic
1203581247 Un_KI270746v1:8063-8085 ATGTCCTAACATATTTGTGTTGG - Intergenic
1187762712 X:22605585-22605607 GTCTCCTAAAATATGTGAGCTGG + Intergenic
1191572780 X:62653081-62653103 GTCTCCTAACATCCATTTGCAGG - Intergenic
1198305882 X:135382624-135382646 GGGTACTACCTTCTGTGTGCTGG + Intergenic
1201346994 Y:12995666-12995688 GTGTAAAAACATCTGTGTACTGG - Intergenic