ID: 1007966005

View in Genome Browser
Species Human (GRCh38)
Location 6:46004333-46004355
Sequence TTCCTCTGTGCAAGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007966005_1007966009 -1 Left 1007966005 6:46004333-46004355 CCAGCTTCCCTTGCACAGAGGAA No data
Right 1007966009 6:46004355-46004377 ACAGCCACAGGATTGAGCTCTGG 0: 1
1: 0
2: 2
3: 25
4: 223
1007966005_1007966014 17 Left 1007966005 6:46004333-46004355 CCAGCTTCCCTTGCACAGAGGAA No data
Right 1007966014 6:46004373-46004395 TCTGGACTATGGAAAGTGGGTGG 0: 1
1: 0
2: 0
3: 22
4: 238
1007966005_1007966012 13 Left 1007966005 6:46004333-46004355 CCAGCTTCCCTTGCACAGAGGAA No data
Right 1007966012 6:46004369-46004391 GAGCTCTGGACTATGGAAAGTGG No data
1007966005_1007966013 14 Left 1007966005 6:46004333-46004355 CCAGCTTCCCTTGCACAGAGGAA No data
Right 1007966013 6:46004370-46004392 AGCTCTGGACTATGGAAAGTGGG 0: 1
1: 0
2: 0
3: 17
4: 158
1007966005_1007966011 6 Left 1007966005 6:46004333-46004355 CCAGCTTCCCTTGCACAGAGGAA No data
Right 1007966011 6:46004362-46004384 CAGGATTGAGCTCTGGACTATGG 0: 1
1: 0
2: 2
3: 14
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007966005 Original CRISPR TTCCTCTGTGCAAGGGAAGC TGG (reversed) Intronic