ID: 1007967627

View in Genome Browser
Species Human (GRCh38)
Location 6:46016357-46016379
Sequence ATGGCAAATGCCCCTTTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 126}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007967627_1007967632 -4 Left 1007967627 6:46016357-46016379 CCACCAAAAGGGGCATTTGCCAT 0: 1
1: 0
2: 0
3: 17
4: 126
Right 1007967632 6:46016376-46016398 CCATCCTTGGGCTAAGCAAAAGG No data
1007967627_1007967638 13 Left 1007967627 6:46016357-46016379 CCACCAAAAGGGGCATTTGCCAT 0: 1
1: 0
2: 0
3: 17
4: 126
Right 1007967638 6:46016393-46016415 AAAAGGAGAGTAGGGTGCTGGGG 0: 1
1: 0
2: 1
3: 47
4: 451
1007967627_1007967636 11 Left 1007967627 6:46016357-46016379 CCACCAAAAGGGGCATTTGCCAT 0: 1
1: 0
2: 0
3: 17
4: 126
Right 1007967636 6:46016391-46016413 GCAAAAGGAGAGTAGGGTGCTGG 0: 1
1: 0
2: 2
3: 22
4: 266
1007967627_1007967642 23 Left 1007967627 6:46016357-46016379 CCACCAAAAGGGGCATTTGCCAT 0: 1
1: 0
2: 0
3: 17
4: 126
Right 1007967642 6:46016403-46016425 TAGGGTGCTGGGGACGGGCAGGG 0: 1
1: 0
2: 3
3: 30
4: 462
1007967627_1007967639 17 Left 1007967627 6:46016357-46016379 CCACCAAAAGGGGCATTTGCCAT 0: 1
1: 0
2: 0
3: 17
4: 126
Right 1007967639 6:46016397-46016419 GGAGAGTAGGGTGCTGGGGACGG 0: 1
1: 0
2: 9
3: 107
4: 1022
1007967627_1007967640 18 Left 1007967627 6:46016357-46016379 CCACCAAAAGGGGCATTTGCCAT 0: 1
1: 0
2: 0
3: 17
4: 126
Right 1007967640 6:46016398-46016420 GAGAGTAGGGTGCTGGGGACGGG 0: 1
1: 0
2: 2
3: 60
4: 530
1007967627_1007967635 5 Left 1007967627 6:46016357-46016379 CCACCAAAAGGGGCATTTGCCAT 0: 1
1: 0
2: 0
3: 17
4: 126
Right 1007967635 6:46016385-46016407 GGCTAAGCAAAAGGAGAGTAGGG 0: 1
1: 0
2: 0
3: 12
4: 190
1007967627_1007967644 28 Left 1007967627 6:46016357-46016379 CCACCAAAAGGGGCATTTGCCAT 0: 1
1: 0
2: 0
3: 17
4: 126
Right 1007967644 6:46016408-46016430 TGCTGGGGACGGGCAGGGCAGGG 0: 1
1: 0
2: 6
3: 102
4: 879
1007967627_1007967637 12 Left 1007967627 6:46016357-46016379 CCACCAAAAGGGGCATTTGCCAT 0: 1
1: 0
2: 0
3: 17
4: 126
Right 1007967637 6:46016392-46016414 CAAAAGGAGAGTAGGGTGCTGGG No data
1007967627_1007967643 27 Left 1007967627 6:46016357-46016379 CCACCAAAAGGGGCATTTGCCAT 0: 1
1: 0
2: 0
3: 17
4: 126
Right 1007967643 6:46016407-46016429 GTGCTGGGGACGGGCAGGGCAGG 0: 1
1: 0
2: 12
3: 119
4: 1062
1007967627_1007967641 22 Left 1007967627 6:46016357-46016379 CCACCAAAAGGGGCATTTGCCAT 0: 1
1: 0
2: 0
3: 17
4: 126
Right 1007967641 6:46016402-46016424 GTAGGGTGCTGGGGACGGGCAGG 0: 1
1: 0
2: 2
3: 46
4: 483
1007967627_1007967634 4 Left 1007967627 6:46016357-46016379 CCACCAAAAGGGGCATTTGCCAT 0: 1
1: 0
2: 0
3: 17
4: 126
Right 1007967634 6:46016384-46016406 GGGCTAAGCAAAAGGAGAGTAGG 0: 1
1: 1
2: 0
3: 18
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007967627 Original CRISPR ATGGCAAATGCCCCTTTTGG TGG (reversed) Intronic
902173253 1:14629955-14629977 TTGGCAAATGCTGCATTTGGGGG - Intronic
902526245 1:17059550-17059572 ATGGTAACTGCCACATTTGGAGG + Intergenic
905535675 1:38719987-38720009 ATGGAAAATGCACATTATGGAGG + Intergenic
916237012 1:162600037-162600059 TTGCCAAATGCCCCTTTGGGTGG - Intergenic
916440398 1:164819282-164819304 ATGGCTAATGGCCCTTCTTGAGG + Intronic
922726143 1:227923918-227923940 ATGGCTAGTGCCCCGTTTGGTGG + Intronic
923841989 1:237682788-237682810 ATGGCACATGCTCCTTTTTTTGG - Intronic
1067750648 10:48969094-48969116 GTGGCCAATGGCCCCTTTGGGGG - Exonic
1068590009 10:58843725-58843747 ATGGAACAGGCTCCTTTTGGGGG + Intergenic
1070156291 10:73837633-73837655 ATAGGAAGTGCCTCTTTTGGGGG - Intronic
1075292423 10:121241828-121241850 CTGGCAAATTCTCTTTTTGGGGG - Intergenic
1077265652 11:1648285-1648307 ATGGCAAATGCTCCTGAAGGCGG + Intergenic
1079950806 11:26801541-26801563 ATTGCTAATGCCCCTTTCTGTGG + Intergenic
1085600594 11:77853107-77853129 TTGCCAAATTCCCCTTTTTGGGG + Intronic
1089258213 11:117205337-117205359 ATGGCAGATGCACATGTTGGAGG - Exonic
1097057595 12:56258972-56258994 TTGGAAAATGCCCCTTCTGTTGG - Intergenic
1098258927 12:68647400-68647422 ATGGCAAAACCCTTTTTTGGGGG - Intronic
1104011039 12:124930160-124930182 ATGGCAAATGGCCTTTGGGGGGG + Intergenic
1104451801 12:128875271-128875293 ATGGCAAATGCCACTGGAGGTGG + Intronic
1104944793 12:132410764-132410786 ATGGCAAAGGACCTTTTTGGGGG + Intergenic
1106054310 13:26223574-26223596 TAAGCAAATGTCCCTTTTGGGGG + Intergenic
1106386987 13:29296465-29296487 GTGGCTAATGCCACTTTGGGAGG - Intronic
1106419306 13:29572358-29572380 CTGGCACCTGCCCCTTTAGGTGG - Intronic
1107630262 13:42335361-42335383 ATGGCTTTAGCCCCTTTTGGAGG - Intergenic
1107926394 13:45266650-45266672 TTGGCAAAAGGCCTTTTTGGGGG + Intronic
1108495974 13:51025793-51025815 ATGGCAAATGTCCCTGATGCTGG - Intergenic
1113138727 13:107122879-107122901 ATTGCAACTGCCTCTTTTTGAGG - Intergenic
1116071409 14:40050481-40050503 ATGGAAAATGCCTATTTTGGGGG + Intergenic
1118918911 14:70132168-70132190 TTGGTGAGTGCCCCTTTTGGTGG + Intronic
1121095764 14:91217069-91217091 ATGGGACCTGCCCCTCTTGGAGG + Intronic
1121127252 14:91416408-91416430 ATGAAAAAGTCCCCTTTTGGAGG - Intronic
1121674995 14:95745340-95745362 ATGGCAAATGACTCTTGAGGGGG - Intergenic
1121971228 14:98358293-98358315 ATGGCAAATGCCACTGTTGAAGG + Intergenic
1125710091 15:41777846-41777868 AAGGTACATGCCCCTTTTGGGGG + Intronic
1125902595 15:43362752-43362774 ATGGTAAATACCCCTGTTGGAGG - Intronic
1128352982 15:66903815-66903837 ATGGCAAATGCCGCCTCTGGTGG - Intergenic
1128577025 15:68783278-68783300 ATGTGAAAGGCCCCTTCTGGAGG + Intronic
1128906079 15:71468828-71468850 AGGGCATATGCCCTTTTTGCTGG - Intronic
1129821249 15:78603541-78603563 ATGGCAGTTGCTCCCTTTGGAGG - Intronic
1131941623 15:97572975-97572997 ATGGCAAATACCCATTCTGGGGG - Intergenic
1137256957 16:46783510-46783532 ATTTCAAATGGCCATTTTGGGGG + Intronic
1137450731 16:48571333-48571355 ATAGCAATAGCCCCTTTTGAGGG - Intronic
1139618205 16:68113959-68113981 ATGGCGACTGCCCCTTTCCGTGG + Intronic
1141172150 16:81698218-81698240 ATGGCAAATGCCCTTGGCGGTGG - Intronic
1143557810 17:7673431-7673453 ATGGCAAATGCCCCAATTGCAGG + Intronic
1144388763 17:14774149-14774171 AAGAGAAATGGCCCTTTTGGTGG - Intergenic
1145274608 17:21422170-21422192 ATGGCAGATGCTCCCTCTGGAGG + Intergenic
1145312459 17:21708068-21708090 ATGGCAGATGCTCCCTCTGGAGG + Intergenic
1147858159 17:43498830-43498852 ATGGCTAATTCTTCTTTTGGGGG + Intronic
1148544739 17:48509002-48509024 ATGGCTCATGCCGCTTTGGGAGG + Intergenic
1148786411 17:50148249-50148271 ATGGGAGCTGCCCCTTTTGGGGG - Intronic
1149419082 17:56491041-56491063 ATGACCAATGCCCCATTTTGAGG + Intronic
1149872228 17:60193012-60193034 ATGGCAAATGCCCCTTCCTAGGG - Intronic
1152317620 17:79590060-79590082 GAGACAAATGCCCCATTTGGGGG + Intergenic
1152630826 17:81410053-81410075 AGGGCAACTGCCCATTTTAGAGG - Intronic
1153986800 18:10357902-10357924 TAGGCAAATGCCCCAGTTGGAGG - Intergenic
1155948111 18:31878089-31878111 GTGGCAGCTGCCCGTTTTGGTGG + Intronic
1156519889 18:37713374-37713396 ATGCAAAATGCCCCTCGTGGAGG - Intergenic
1161057147 19:2196282-2196304 CTGGCAGATGAACCTTTTGGAGG + Intronic
1164479556 19:28601006-28601028 GGAGCAAATGCCCCCTTTGGAGG + Intergenic
1164885004 19:31770935-31770957 AAGGCAAATCTCCCTGTTGGAGG - Intergenic
1167193706 19:48010914-48010936 AGGGCAGATGCCCCTGTAGGTGG - Intronic
928335949 2:30398306-30398328 ATGTCATCTGCTCCTTTTGGAGG + Intergenic
929540758 2:42818811-42818833 GTGGCTTATGCCCCTTTGGGAGG + Intergenic
931014146 2:57956122-57956144 GTGGCTAATGCCGCTTTGGGAGG + Intronic
932613884 2:73219739-73219761 ATGGGAAAAGCCCAGTTTGGGGG + Intronic
932961466 2:76417218-76417240 TGGGCAAATGCCTCTATTGGAGG - Intergenic
933302036 2:80552050-80552072 ATGGCAAACGGCCGTCTTGGTGG + Intronic
933564818 2:83937412-83937434 ATGACAGACGTCCCTTTTGGGGG - Intergenic
935431585 2:102981687-102981709 GTGGCAAATGCCTCTTTTCTAGG + Intergenic
936227910 2:110674674-110674696 CTGGCAACTGCCCCTCATGGTGG - Intronic
938828091 2:135026674-135026696 ATGTCAAATGCTCTTTTAGGAGG - Intronic
946187426 2:217988863-217988885 ATGACACAAGCACCTTTTGGGGG + Intronic
947115631 2:226767477-226767499 ATGGCTAAGGGCCCTTTTGTTGG - Intronic
1169505184 20:6202559-6202581 ATGGTAAATGCCCTTTCTGCAGG + Intergenic
1173922205 20:46754787-46754809 ATGTCAAATGCCCCCTTGGGTGG + Intergenic
1175305503 20:57973201-57973223 TTGTCAAATGCCCCCTGTGGGGG + Intergenic
1178982032 21:37272401-37272423 ATGGCATTTGTCCCTTCTGGAGG + Intergenic
1180258503 21:46650598-46650620 AAGGCAAATGCCCCTTCAGGGGG - Intronic
953292949 3:41684625-41684647 ATGACAAAAGCCCCTTGGGGTGG - Intronic
954936932 3:54335180-54335202 ATGGCAAATGCTACTATTGCAGG + Intronic
958771627 3:98433048-98433070 ATGGTGAATGCCCATTATGGGGG + Intergenic
959842280 3:110991300-110991322 ATGGTAAATCCCCCCTTTGTTGG + Intergenic
960838297 3:121930096-121930118 CTAGAAAATGCCCCTTCTGGGGG - Intronic
963294356 3:143529181-143529203 GTGGGAAATGCCCCTCTGGGAGG + Intronic
963756035 3:149235740-149235762 ATGGCAGCTGCCCCTTTTCCTGG - Intergenic
965554947 3:170009095-170009117 AGGACAAATGCCCTGTTTGGAGG + Intergenic
967102158 3:186224432-186224454 GTGGCAAATGACACATTTGGAGG - Intronic
968474479 4:796808-796830 CTGGCAAATGGGCCTTTTGCAGG - Intronic
972380381 4:38514004-38514026 ATGTCAAAGGCCACTTTGGGAGG - Intergenic
974251689 4:59393892-59393914 CTGGCAAGTGCCCCTCTGGGAGG - Intergenic
976109916 4:81661319-81661341 ATTGGAAATGGCCATTTTGGAGG - Intronic
976708697 4:88045645-88045667 TTGTCAAATGCCCATTTTGTAGG - Intronic
979880287 4:125948218-125948240 TTGGCAAATGGCTCTTTTCGGGG - Intergenic
979979881 4:127241852-127241874 ATAGTAAATGCTCCTTTTGTTGG - Intergenic
984332964 4:178350194-178350216 ATAACAAATGCCACTTTGGGAGG - Intergenic
988425826 5:31062789-31062811 ATGGAAAATGCCCTTTTGAGAGG + Intergenic
988913409 5:35868981-35869003 ATGGCATAGGCCCCTTTGGAAGG + Intronic
992299464 5:75363633-75363655 ATGGCAAATGCCTCTCTCTGGGG - Intergenic
995182772 5:109244438-109244460 ATGGCTATTGTCCCTTCTGGAGG - Intergenic
998160878 5:139812370-139812392 AGTGCAAAGGCCTCTTTTGGGGG + Intronic
998611427 5:143693391-143693413 ATGGAAAATGCTGCTTTTTGAGG + Intergenic
1001710929 5:173777452-173777474 TTGGCAAAGGACCCTTCTGGTGG + Intergenic
1003286938 6:4742660-4742682 ATGGCAAAGACTCCCTTTGGGGG + Intronic
1004414338 6:15411725-15411747 ATGCCAGATGCCCATGTTGGAGG - Intronic
1004961942 6:20800014-20800036 ATTGCAAATCCCCCCTTTGCAGG + Intronic
1005814696 6:29541142-29541164 AGAGAAAATGCCCATTTTGGAGG + Intergenic
1007967627 6:46016357-46016379 ATGGCAAATGCCCCTTTTGGTGG - Intronic
1008888373 6:56456391-56456413 ATGGCAAATGTACTGTTTGGTGG + Intergenic
1011065571 6:83321915-83321937 CTGGCAGGTGCCCCTCTTGGGGG + Intronic
1013757948 6:113483124-113483146 ATTGCAAATCACACTTTTGGAGG - Intergenic
1014082637 6:117305201-117305223 ATGGCAATAGCCCTTTTTTGTGG - Intronic
1018332148 6:162741174-162741196 ATGACAAAAGCACCTTGTGGTGG - Intronic
1018773837 6:166996269-166996291 ATTGCAAATGCAGCTTTTTGTGG - Intergenic
1021484925 7:21157311-21157333 ATGGAAGATGCCCCTATGGGAGG - Intergenic
1027380366 7:77602408-77602430 ATGGAAAATACCCCTTTAAGAGG + Intronic
1033627937 7:143129207-143129229 ATGGCGAATACACCTTTGGGTGG - Intergenic
1038066131 8:23965536-23965558 ATGGGAAACACCCCTCTTGGTGG - Intergenic
1040089679 8:43385043-43385065 ATGGCAAATGGCAGTTATGGGGG - Intergenic
1040286402 8:46102704-46102726 ATGGAAAAGGCCTCTTTTGGAGG + Intergenic
1040287724 8:46109012-46109034 ATGGGAGATGCCTCTTTGGGAGG + Intergenic
1040290276 8:46120629-46120651 ATGGAAGAGGCCTCTTTTGGAGG + Intergenic
1040301039 8:46188160-46188182 ATGGGATAGGCCCCTTTGGGAGG + Intergenic
1040313648 8:46249686-46249708 ATGGGAAATGCATCTTTGGGAGG - Intergenic
1040402406 8:47064616-47064638 ATGGCAAATGGCAGTTATGGGGG + Intergenic
1041680287 8:60582203-60582225 ATGGCTCATGCCACTTTGGGAGG - Intronic
1041755090 8:61304914-61304936 ATCACAATTGCCCTTTTTGGTGG + Intronic
1047349107 8:124056277-124056299 ATAGCAGTGGCCCCTTTTGGGGG - Intronic
1048535485 8:135290590-135290612 GTGCCAAAAGGCCCTTTTGGGGG - Intergenic
1051411415 9:16793619-16793641 AAGGCAAGTACCCCTTTGGGTGG - Intronic
1054860690 9:69949840-69949862 ATGGCAATTGCCTCTTTGGGTGG + Intergenic
1055045546 9:71920476-71920498 AAGGAAAATGGCCCATTTGGGGG - Intronic
1056623878 9:88237813-88237835 GTGGGAAATGCCCCCTTTTGGGG - Intergenic
1060035237 9:120249837-120249859 ATGACCTTTGCCCCTTTTGGAGG + Intergenic
1185831520 X:3307700-3307722 TTGCCAAATGCCCCTTTAGGGGG - Intergenic
1186162703 X:6794391-6794413 ATGGCAAATGCCCTATATAGGGG - Intergenic
1188557025 X:31424075-31424097 ATGGTAAATGCCCCCTCTGCTGG + Intronic
1194642321 X:96417274-96417296 ATGGCATAATCCCCTTTTGATGG + Intergenic
1194844232 X:98783646-98783668 AAGGCAAAGGGCCCTTTTGAAGG + Intergenic
1195698732 X:107685875-107685897 ATGGCAAATGCCCCTTTGACTGG - Intergenic
1196088819 X:111716564-111716586 AATGCAAATACCCCTTGTGGTGG + Intronic
1198085711 X:133279696-133279718 CTGGCAGGTGCCCCTTTGGGAGG + Intergenic
1200142100 X:153907519-153907541 CTGGCCCAGGCCCCTTTTGGAGG - Exonic
1201619421 Y:15939227-15939249 ATAACAAATGCTCCTTTTGCAGG + Intergenic