ID: 1007968195

View in Genome Browser
Species Human (GRCh38)
Location 6:46023418-46023440
Sequence TCCCTCCATTGCTAAAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007968193_1007968195 17 Left 1007968193 6:46023378-46023400 CCAAGGTCATGTGGATAGTTATA 0: 1
1: 0
2: 1
3: 7
4: 136
Right 1007968195 6:46023418-46023440 TCCCTCCATTGCTAAAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007968195 Original CRISPR TCCCTCCATTGCTAAAGCCC AGG Intronic
No off target data available for this crispr