ID: 1007968805

View in Genome Browser
Species Human (GRCh38)
Location 6:46029869-46029891
Sequence TTTAATCCCTAACAGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007968805_1007968813 30 Left 1007968805 6:46029869-46029891 CCCTGCTCCTGTTAGGGATTAAA 0: 1
1: 0
2: 1
3: 10
4: 103
Right 1007968813 6:46029922-46029944 TCCAGATCTGCAGTTGTGATGGG 0: 1
1: 0
2: 1
3: 16
4: 163
1007968805_1007968812 29 Left 1007968805 6:46029869-46029891 CCCTGCTCCTGTTAGGGATTAAA 0: 1
1: 0
2: 1
3: 10
4: 103
Right 1007968812 6:46029921-46029943 TTCCAGATCTGCAGTTGTGATGG 0: 1
1: 0
2: 1
3: 12
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007968805 Original CRISPR TTTAATCCCTAACAGGAGCA GGG (reversed) Intronic
901124284 1:6918121-6918143 ATTCTTCCCAAACAGGAGCATGG - Intronic
903011549 1:20334419-20334441 CTTTATCCCTACCAGTAGCAGGG - Intronic
905125586 1:35714005-35714027 TTTCATCCCTGACAGGTGGATGG - Exonic
906315834 1:44785987-44786009 TTTAATACCTAACAGTTGTATGG - Intronic
909119294 1:71580690-71580712 ATAAATCCCTACCAGGAGCCAGG + Intronic
911874824 1:103147294-103147316 TTAACTCCCTAAAAAGAGCATGG + Intergenic
911888743 1:103340099-103340121 TGTAATCCCTAAAAGAAGCATGG + Intergenic
918891338 1:190274099-190274121 TTTTACCCCTACCAGGAGGATGG + Intronic
918992512 1:191716066-191716088 TTTCATCCATAAAAGCAGCAGGG + Intergenic
921785283 1:219222102-219222124 TTTAATCCCTCTTGGGAGCAGGG + Intergenic
921945515 1:220883520-220883542 GTTTATCCTTAACAGGGGCAAGG + Intronic
923294487 1:232580503-232580525 TAAAATGCCTGACAGGAGCATGG + Intergenic
923700656 1:236297164-236297186 TTTATTGGGTAACAGGAGCAGGG - Intergenic
924133746 1:240940430-240940452 TATATTCCCTAACAGGTGTAAGG - Intronic
1062863916 10:833451-833473 TTTAATCCCAAACAAAAGGAGGG + Intronic
1064628852 10:17288498-17288520 TTGAATCCTTAAAAGGTGCAGGG - Intergenic
1067364734 10:45615183-45615205 TTTCATTTCTTACAGGAGCAGGG + Intergenic
1073329307 10:102660454-102660476 TTTAGCCCCAAACAGGTGCACGG - Intergenic
1078376027 11:10793918-10793940 GTTAATCTCTAACACAAGCAGGG - Intergenic
1081305210 11:41503481-41503503 TTTAAACCAGAGCAGGAGCAGGG - Intergenic
1081372981 11:42326602-42326624 TTCAATCCTCAACAGGAACAAGG + Intergenic
1099211660 12:79798556-79798578 CTTCATCCCTAACAGGAGTGAGG + Exonic
1102063151 12:109950516-109950538 ATTAATCCCTAAAAGGAGTGTGG - Intronic
1104616635 12:130275835-130275857 TTTAATCCACACCATGAGCAAGG - Intergenic
1107224364 13:38029331-38029353 TTTGATCACAAACAAGAGCATGG - Intergenic
1108530196 13:51321186-51321208 TTTAATACCTAATGGGAGCTAGG - Intergenic
1109303871 13:60617895-60617917 TTTACTCCCTCACAGGAGGCTGG + Intergenic
1113537608 13:111080752-111080774 TTTAATCCCTTCCAGGAGGAAGG - Intergenic
1118788084 14:69063524-69063546 CTTAGTCCCTACCAGGAGCATGG + Intronic
1122654110 14:103245686-103245708 TTTACCCCCTAACAGGGCCACGG + Intergenic
1202835100 14_GL000009v2_random:72112-72134 TTTAATCACAAACAGGAGGTTGG + Intergenic
1128257650 15:66210468-66210490 TTTGATCGCTAAGGGGAGCAGGG + Intronic
1133779891 16:8929850-8929872 TTTCATCCCTAACAGGAGCGGGG + Intronic
1139544644 16:67644670-67644692 TTGGATCCCTAACAGGGTCACGG + Intergenic
1140088493 16:71817710-71817732 TGTCATTCCTAACAGGAGAATGG - Intergenic
1142525449 17:537201-537223 TTGAATCCCTCGCAGGAGAACGG + Intronic
1142788593 17:2245069-2245091 ATGAAACTCTAACAGGAGCAAGG + Intronic
1147451153 17:40505314-40505336 TTCAATCCCTGAAAGGAGCATGG - Intergenic
1148004914 17:44419422-44419444 CATAACCCCTAACAGGAGGAAGG - Intronic
1148982343 17:51589119-51589141 TTTTCTTCCTAACAGCAGCAGGG - Intergenic
1150511609 17:65758365-65758387 TTTAATTCCTAACAAAAGCTTGG + Intronic
1150587326 17:66530885-66530907 TTTAATCCATACCAGGGGCAAGG - Intronic
1161839988 19:6674251-6674273 ATGAATCCCAAACAGGAGAAAGG + Intergenic
926418986 2:12679141-12679163 ATTAATCCCTATTATGAGCAAGG + Intergenic
926497733 2:13612419-13612441 ATTAATACCTAACTGAAGCAGGG + Intergenic
928423999 2:31163106-31163128 GTTAATCCCTATCAGGAGTGTGG - Intergenic
929403862 2:41617465-41617487 TTTTTTCCCTAACATGAGCTTGG - Intergenic
933177447 2:79191509-79191531 TGTAATGCCTACCATGAGCAAGG + Intronic
944593037 2:201236196-201236218 CTAAATGCCTAAAAGGAGCAGGG - Intronic
948507424 2:238438536-238438558 CTTACTCCCTCACTGGAGCACGG + Intronic
949074131 2:242044457-242044479 GTTCATCCCTAACAGGAGCTGGG + Intergenic
1169459053 20:5778672-5778694 TTTCAGCCATGACAGGAGCAGGG + Intronic
1172463108 20:35134967-35134989 TATGATCCCGGACAGGAGCAGGG + Intronic
1180714074 22:17859647-17859669 TTTCAACCTTACCAGGAGCAAGG + Intronic
1181761475 22:25061764-25061786 ATTAAGCCCTACCAGGAGCTGGG - Intronic
949636579 3:5988822-5988844 TTTAATACCTGTCAGGAGAAAGG + Intergenic
950972402 3:17202446-17202468 TTGAATCCCTCCCAGGAACATGG - Intronic
951420610 3:22479803-22479825 TATAATACCTAACAGTAGCTTGG - Intergenic
954821514 3:53333115-53333137 TTTCATCACTGACAGCAGCAGGG + Intronic
966325677 3:178751079-178751101 TTTTTTGCCTACCAGGAGCATGG + Intronic
966404455 3:179581228-179581250 TTTAAACCGTAACAGGAGACTGG - Intronic
967458914 3:189722501-189722523 TTGAATCCCAAACAGGGGCAGGG + Intronic
969692443 4:8711060-8711082 TTCAGTCCCTGCCAGGAGCAGGG + Intergenic
973367773 4:49221600-49221622 TTTAATCACAAACAGGAGGTTGG - Intergenic
977611943 4:99044773-99044795 GTTATTCCCTAGCAGGAGTAAGG + Intronic
978449111 4:108810427-108810449 TTTAATTCCTACCAGAAGAAAGG - Intergenic
979288025 4:118948807-118948829 TTTAATCCCCAACTGGAGGTGGG - Intronic
984735223 4:183101476-183101498 TTTAAGACCTAACAGCTGCAAGG - Intronic
985602945 5:844308-844330 TTTAATCCCCACAAGGAACAAGG + Intronic
986326831 5:6682125-6682147 TCAAATCCCTCACAGGAGCAGGG + Intergenic
988500723 5:31781444-31781466 TTTACCCCCTAACAGAAGCCTGG - Intronic
991308177 5:65203976-65203998 ATTCTTCCCTAACACGAGCAGGG - Intronic
994114238 5:96044127-96044149 TTTCACTCCTAACAGCAGCATGG - Intergenic
1002044701 5:176535451-176535473 TTTAAGCCCTGCCAGGAACAGGG + Intronic
1003722226 6:8716759-8716781 TTTACTACCAAAGAGGAGCAGGG - Intergenic
1007968805 6:46029869-46029891 TTTAATCCCTAACAGGAGCAGGG - Intronic
1008325212 6:50171848-50171870 GTTAATCCATAACATGGGCAAGG + Intergenic
1009042186 6:58191797-58191819 ATGAATACCTAAAAGGAGCAAGG - Intergenic
1009218023 6:60946031-60946053 ATGAATACCTAAAAGGAGCAAGG - Intergenic
1009456134 6:63858637-63858659 CCTAATCCCAGACAGGAGCAAGG - Intronic
1010309215 6:74363976-74363998 TGCAATGCCTAGCAGGAGCATGG + Intergenic
1012832691 6:104225575-104225597 TTAAATACCTTAGAGGAGCAAGG + Intergenic
1013720336 6:113018789-113018811 TTAGATCCCTAAGAGAAGCAAGG + Intergenic
1017172435 6:151470568-151470590 TTTAATGCTTAGCAGGAGGAAGG + Intergenic
1018359429 6:163052376-163052398 TTTAATTGCTAATAGAAGCAAGG + Intronic
1018887511 6:167952269-167952291 TTTAATCCTTATCACGATCAGGG - Intronic
1020217619 7:6206652-6206674 TTTAATCCTTAACAGAAGAAGGG + Intronic
1021006717 7:15405114-15405136 TTTAATCCCTAAGAGGACAAGGG - Intronic
1034178117 7:149116347-149116369 TTTGTTCACTAACAGGAGGAAGG - Intronic
1034840477 7:154391026-154391048 TTTAATCCCAAACAGTAGGTGGG - Intronic
1040904962 8:52458830-52458852 TTTTTTCCCTAGCAGCAGCAGGG - Intronic
1041554768 8:59141303-59141325 TTTTAGCCCTAACAGCACCATGG - Intergenic
1042290091 8:67161384-67161406 TCTAATCACTAACAGCATCATGG - Intronic
1042742707 8:72068563-72068585 TTTAATGACTAAAAGGAGGAAGG - Intronic
1046159543 8:110342306-110342328 CTTATTCACTATCAGGAGCAGGG + Intergenic
1046328229 8:112678138-112678160 TCAAATGCTTAACAGGAGCAAGG - Intronic
1047742478 8:127817956-127817978 TTTAAACACCAACAGGAACAAGG - Intergenic
1049103142 8:140593741-140593763 TTTAATCCTTACCACGGGCAAGG + Intronic
1051713313 9:19955752-19955774 TTTAAGCCCTCAGATGAGCAAGG + Intergenic
1052873129 9:33527694-33527716 TTTAATTCCTAAAAGTACCATGG - Intronic
1057056684 9:91967015-91967037 AATAAACCCTGACAGGAGCAGGG - Intergenic
1057153114 9:92812553-92812575 TTTAATTCCTAAAAGTACCATGG - Intergenic
1057683432 9:97212500-97212522 TTTAATTCCTAAAAGTACCATGG + Intergenic
1057870445 9:98712656-98712678 TCTAACTCCTAACAGCAGCAAGG + Intergenic
1059032181 9:110710688-110710710 TTTAATGGCTAACAGGAGAGAGG + Intronic
1185626056 X:1483337-1483359 TTAAAACCCAAACAGGAGCCAGG + Intronic
1186446624 X:9635377-9635399 TTTAATCCCAAATAAAAGCATGG - Intronic
1186962884 X:14756638-14756660 TTTATTGGGTAACAGGAGCAAGG - Intergenic
1188015702 X:25105479-25105501 TTTAATCCTTAAAGGGACCAAGG + Intergenic
1189641444 X:43076238-43076260 ATTATTCCCTAAAAGGAGCTCGG + Intergenic
1192351307 X:70358924-70358946 TTTAATCCCTGTCAGCAGTATGG + Intronic
1193138038 X:77994940-77994962 TATAAGCCCTAACAGATGCAGGG - Intronic
1196594116 X:117523139-117523161 TTGAACCCCAAACAGGAGCTAGG + Intergenic
1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG + Intronic
1201617668 Y:15919876-15919898 TTTAGTCCTTAACAGTAACAGGG + Intergenic