ID: 1007969237

View in Genome Browser
Species Human (GRCh38)
Location 6:46034070-46034092
Sequence TTCTTCCTGTTACCAGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 217}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007969237 Original CRISPR TTCTTCCTGTTACCAGTGTC TGG Intronic
900985815 1:6072326-6072348 TTCTTCCTGTCTCCAGCGACTGG - Intronic
903315778 1:22504834-22504856 TGCTTACTCTTACCAGTATCTGG + Intronic
904255063 1:29249518-29249540 TTCTCCCTGTTCCCAGTCTGAGG + Intronic
906656650 1:47553124-47553146 TACTTGCTGTTCCCAGTGCCCGG + Intergenic
907004609 1:50898833-50898855 TTCTTCATGTTCCCTGTGTTTGG + Intronic
907625254 1:56023201-56023223 TTCTTTTTGTTCCCAGTTTCGGG - Intergenic
910227205 1:84947941-84947963 TTCTGCCTGTTCCCAGGGGCAGG - Intronic
910750551 1:90625414-90625436 TTCTATTTGTTACCAGTATCTGG + Intergenic
910859275 1:91727878-91727900 GTCTTCATGTTTCTAGTGTCTGG + Intronic
910926619 1:92404378-92404400 TTCTTCCTGTTTACATTGACAGG + Intergenic
912531440 1:110326398-110326420 CTCTTGCTGTTTCTAGTGTCTGG - Intergenic
914087537 1:144466696-144466718 TTCATGTTGTTATCAGTGTCTGG + Intergenic
914311074 1:146467511-146467533 TTCATGTTGTTATCAGTGTCTGG - Intergenic
915766773 1:158371250-158371272 CTCTTTCTGTTACCAGAGACTGG + Intergenic
916533509 1:165680864-165680886 CTCTTTCTGTTCCCAGTTTCGGG - Intronic
917044312 1:170840770-170840792 TTCTTCCTGTTACAAATGACAGG + Intergenic
919382536 1:196876506-196876528 TTTATCCTTTCACCAGTGTCAGG + Intronic
919392450 1:197004327-197004349 TTCTTACTGTTTCTAGTCTCAGG - Intronic
921168923 1:212528383-212528405 TTTTTCCTGATACCATTGCCAGG + Intergenic
921500387 1:215895284-215895306 ATCTTTCTATCACCAGTGTCTGG - Intronic
923169896 1:231405719-231405741 TTCTTCCTCTTAGAATTGTCTGG - Intronic
1063869741 10:10404696-10404718 TTCTTCCTTTTACTTGTGTCTGG - Intergenic
1065318699 10:24488739-24488761 TTTTTCCTCATACCAGAGTCAGG + Intronic
1066101603 10:32122842-32122864 TTCTCCCTGTTGTCAGTGCCTGG - Intergenic
1067262302 10:44704740-44704762 TTCTTCCAGTTTCCAGTCTATGG - Intergenic
1067733096 10:48827902-48827924 TTCTTCCTGTTTCAAGAGTTAGG + Intronic
1067842696 10:49694104-49694126 TCCTTCCTGTTTCCAATGTTTGG - Intronic
1069945811 10:71984842-71984864 TCCTTCCTGTTCCTAGTGCCTGG + Intronic
1070617973 10:77983620-77983642 TTGTCCCTCTTCCCAGTGTCTGG - Intronic
1071013068 10:80961901-80961923 TTCTTCCATTCACCAGTGTTGGG - Intergenic
1072709752 10:97708339-97708361 TTCTTCTTGTTACAAGTTTCTGG + Intergenic
1073909636 10:108326359-108326381 CTGTTCCTGTTACCAGTGGAAGG - Intergenic
1073953362 10:108837501-108837523 TTGTTCCTTTTAGCACTGTCTGG + Intergenic
1077764280 11:5141227-5141249 TTCTTCCTGCTTCCAGATTCTGG - Intergenic
1079552306 11:21715087-21715109 TTCTTTTTGTTCCCAGTTTCAGG - Intergenic
1079676653 11:23236075-23236097 TTCTTTCTGTTACCAGATTTGGG + Intergenic
1081353770 11:42088232-42088254 TGCTTCCTGTTCCCATTTTCAGG - Intergenic
1082960765 11:58916694-58916716 CTCCTCCTGTTACCAGTGGATGG + Intronic
1082980718 11:59117789-59117811 TTCCTCCTGTTACCAGTGGAGGG + Intronic
1083364451 11:62133110-62133132 GTCTTCCTGATACCAGGCTCTGG + Intronic
1085191735 11:74631785-74631807 TTTTTTCTTTTACCTGTGTCTGG + Intronic
1085478689 11:76804516-76804538 TTCTTCCTGATCCCAGTGGCAGG - Intergenic
1085755188 11:79196157-79196179 TTCTTTTTGTTCCCAGTTTCGGG + Intronic
1085756575 11:79206784-79206806 CTCTTCTTGTTTCCAGTTTCAGG + Intronic
1086029160 11:82332852-82332874 TTCTTCCATTTACCAGTTTTGGG + Intergenic
1086190220 11:84070158-84070180 ATCTTTGTATTACCAGTGTCAGG + Intronic
1088696875 11:112374152-112374174 TTCTTCCTGATACCAAAGCCTGG - Intergenic
1088722121 11:112602767-112602789 TTCCTCCGGTTAGAAGTGTCTGG - Intergenic
1088723663 11:112616300-112616322 TTCTACCTGTGACCAGCCTCAGG - Intergenic
1090147337 11:124339595-124339617 TTCTTCCTGTTTCTAGTGTATGG - Intergenic
1092213981 12:6667679-6667701 TTCTTCCTCTTCCCAGTGGGTGG + Exonic
1092721243 12:11443049-11443071 GTCTTCGTGTTGCTAGTGTCTGG - Intronic
1094792141 12:33927969-33927991 TTCCTCCTCTTACAAGTGTTAGG + Intergenic
1095795686 12:46216407-46216429 TACTTCCTGTTTCCACTGGCTGG - Intronic
1096523109 12:52195086-52195108 TGTGTCCTGTTACCAGTGACAGG - Intergenic
1098292508 12:68970160-68970182 TTCTTGCTCTTAGAAGTGTCTGG - Intronic
1098765632 12:74485159-74485181 TTCTTCCTGTTACCAGGCCCAGG - Intergenic
1100980492 12:100158772-100158794 CTCTTCCTGTGAGCAGTCTCCGG + Intergenic
1101729635 12:107416338-107416360 TTATTTCTGTTAGCAGTTTCTGG + Intronic
1102835339 12:116052752-116052774 TGCTTCCTCTTCCCAGTCTCTGG - Intronic
1102941594 12:116947339-116947361 TTCTCCTTGTTAACACTGTCAGG - Intronic
1106754387 13:32807807-32807829 TTATTCCTCTTACCAGTAACAGG - Intergenic
1107549425 13:41461083-41461105 TCCTTCCTGTTCCCACTTTCAGG + Intronic
1107772244 13:43800606-43800628 TGCGTCCTGATATCAGTGTCTGG - Intergenic
1107779928 13:43888281-43888303 TTCTTCCTTTTACCAGCCCCTGG - Intronic
1108155731 13:47583290-47583312 TTCTTTTTGTTTCCAGTTTCAGG - Intergenic
1108793151 13:53997078-53997100 TTCTTGCTTTTTCCAGTTTCTGG - Intergenic
1109023597 13:57131261-57131283 TTCCTCCTGTTTACAGTGTATGG + Intergenic
1109515832 13:63441486-63441508 TTCTCCCTGTTACCTGTGGAAGG - Intergenic
1113570106 13:111347490-111347512 TTCCTTATGTTACCAGTCTCAGG + Intergenic
1114302702 14:21392710-21392732 TTCCTCCTGTTACCATTTCCTGG + Exonic
1116090883 14:40305325-40305347 TTCTTCCTCATACAAGTGTTTGG - Intergenic
1116895744 14:50312922-50312944 TTCTTCCGGTACCCAGTGCCGGG - Exonic
1117718555 14:58605809-58605831 TTCTTTTTGTCTCCAGTGTCTGG + Intergenic
1117826049 14:59704785-59704807 TTCTTCCTGATCACAGTGTCCGG - Intronic
1121038433 14:90725847-90725869 TGCTTCTTGTTAGCTGTGTCAGG - Intronic
1121654163 14:95583177-95583199 TTCTTTTTGTTCCCAGTTTCAGG - Intergenic
1122253332 14:100456895-100456917 TTCTTCATGTTTCCTGTGCCAGG - Intronic
1123114832 14:105889986-105890008 TTCTTCCTGTGAGCTGTGTGTGG + Intergenic
1123117015 14:105899433-105899455 TTCTTCCTGTGAGCTGTGTGTGG + Intergenic
1123119078 14:105908741-105908763 TTCTTCCTGTGAGCTGTGTGTGG + Intergenic
1124152708 15:27196241-27196263 CTCTTCCTTATACCAGTGTTAGG + Intronic
1125536970 15:40446680-40446702 TTAGTCTTGTTACCAATGTCAGG + Intronic
1126747779 15:51843979-51844001 TTCTTGCTGTTACCTGAGTGTGG + Intronic
1127414849 15:58748812-58748834 TTCTTCCTGTGTCCTGTGTTTGG - Intronic
1128620228 15:69142688-69142710 TTTTCCCTTTTTCCAGTGTCTGG - Intergenic
1129113035 15:73349233-73349255 TTCTCACTGTTTTCAGTGTCAGG - Intronic
1129261879 15:74373313-74373335 TTCTTACTGCAACCAGTGGCTGG + Intergenic
1135656816 16:24257095-24257117 GTCTTGCTGTTAACAGAGTCTGG - Intronic
1138036769 16:53615385-53615407 TTGTTCCTGCTACCACTGTCTGG + Intronic
1138733720 16:59226477-59226499 TTCTTCATGTTTCCAGTGGTTGG - Intergenic
1148074708 17:44928617-44928639 TCCTTCATGTCTCCAGTGTCTGG - Intronic
1150878144 17:68993009-68993031 TTCTTACTATTAGCAGTGCCAGG + Exonic
1154524409 18:15267829-15267851 TTCTTCCACTTACCACTTTCAGG + Intergenic
1155833488 18:30547845-30547867 TTCTTCCTGATTCCTTTGTCAGG + Intergenic
1158129888 18:54140638-54140660 TCTTTTCTCTTACCAGTGTCAGG + Intergenic
1164780464 19:30887367-30887389 TTCTTCCTGTTCTCAAGGTCAGG - Intergenic
1167963133 19:53123332-53123354 TTCTTTCTGCTTCCACTGTCTGG - Intronic
926262551 2:11279855-11279877 ATCTTTCTGTTACCAGTTTCTGG - Intronic
928173153 2:29016337-29016359 CTCTTCCTGCTTCCAGTGTGAGG + Intronic
929657199 2:43745580-43745602 ATCTTCTTGTTTCCAGTTTCAGG + Intronic
930826585 2:55701697-55701719 TTCTTCTTCTTGCCAGTGTTTGG + Intergenic
933762240 2:85680358-85680380 ATCTTCCTGTTCTCAGTGCCTGG + Intergenic
936437824 2:112523129-112523151 TGCTTTCTGTTACCTGTGTGTGG + Intronic
936518525 2:113197733-113197755 TTCTCCCTGCTACCAGTCACAGG - Exonic
938226327 2:129619534-129619556 TGCTCCCTGTTACCAGAGCCAGG - Intergenic
939934716 2:148276866-148276888 TTCTGCATGTTTCCAGTATCAGG + Intronic
939955923 2:148527603-148527625 CTCTTCCTGTTACCTGAATCAGG - Intergenic
941019954 2:160397385-160397407 TCCTTCCTGTAATCACTGTCAGG + Intronic
942752084 2:179299622-179299644 TTCTTCCTGTTTCCTCTATCTGG + Intergenic
943227295 2:185194128-185194150 TTCATCCTGGTACCAGAATCTGG + Intergenic
944480662 2:200154293-200154315 TTCTTCCTGTTGCTATTTTCTGG - Intergenic
945965800 2:216185159-216185181 TTCTTGCTGTTACCAATCCCGGG + Intronic
1170109227 20:12786961-12786983 TTTTTCCTGTTAACAGAGTATGG - Intergenic
1171950516 20:31417518-31417540 TTTTTCCTGTTCCCTGTTTCTGG - Intergenic
1172024901 20:31941821-31941843 TTATTCCTGTTTCAAGTGTTTGG + Intronic
1172959554 20:38788939-38788961 TGCCTCCTGTCACCAATGTCAGG - Intergenic
1173465195 20:43275360-43275382 TCCTTGCTGTTTCCAGTTTCTGG + Intergenic
1175499111 20:59436975-59436997 TTCTTCTTGGTGCCAGTGTTTGG - Intergenic
1175548285 20:59795300-59795322 TTCCTCCTGTTACTAATTTCTGG + Intronic
1177059363 21:16352132-16352154 TTCTTCCTTTTTCCAGTGGAGGG - Intergenic
1183442752 22:37832540-37832562 CTCTTTCTGATACGAGTGTCTGG + Intronic
1183657307 22:39194933-39194955 TTCTATCTGTTTCCATTGTCTGG - Intergenic
949545639 3:5069866-5069888 GTCTGCCTGACACCAGTGTCGGG + Intergenic
950398570 3:12752934-12752956 TCTTTCCTGGTGCCAGTGTCAGG - Intronic
950426458 3:12927198-12927220 TTCTTTTTGTTAACAGTGTGTGG - Intronic
951974189 3:28485214-28485236 ATCTCTCTGTTACCAGTTTCTGG + Intronic
952779648 3:37083314-37083336 TTCTTCTGGTTACAAGTGACTGG - Intronic
953575433 3:44109603-44109625 TTCCTGCAGTCACCAGTGTCAGG - Intergenic
954671600 3:52294068-52294090 CTCTTCCTGTGACCACTGGCGGG + Intergenic
955289483 3:57677733-57677755 TTCTTTCTGTTAAAAGTGACAGG - Intronic
958616798 3:96503926-96503948 TTATTCCTGTTACCATTCTCTGG + Intergenic
959662302 3:108882254-108882276 TTCATCCTCTTAACAGGGTCTGG - Intergenic
960283793 3:115804748-115804770 GTCATCCTGTTACACGTGTCAGG + Exonic
960482974 3:118215678-118215700 TTCATACTGTTACCTGTGGCAGG + Intergenic
961135166 3:124503225-124503247 CACTTCCTGTTACCAGGGCCTGG + Intronic
961817788 3:129560193-129560215 TTCTTCCTGTTTCCCCTGTGGGG - Intronic
962237675 3:133721118-133721140 TTCTTCCTTCTACCAATTTCAGG + Intergenic
963716861 3:148812697-148812719 CTCTTTCTGTTCCCAGTTTCTGG + Intronic
964345054 3:155746571-155746593 TTCTTCCTGGTACTATTGGCAGG - Intergenic
964589065 3:158340645-158340667 CTCTTTCTGTTCCCAGTGTCGGG + Intronic
964589354 3:158342544-158342566 CTCTTTCTGTTCCCAGTTTCAGG + Intronic
966086010 3:176067837-176067859 ATCTTCCTGGCACCAGTGTGTGG - Intergenic
966407023 3:179608510-179608532 TTCTCCCTGTAACCAGTTACAGG - Intronic
967201979 3:187079793-187079815 TTCATCCTGTTCCCAGTGCCAGG - Intergenic
968323486 3:197791654-197791676 TTCTCCCCGTTACCCGGGTCCGG - Intronic
968834285 4:2951622-2951644 TTCTTCCCGTGTCCAGTGTGTGG - Intronic
969219104 4:5747957-5747979 TTCTTTCTGGTTCCATTGTCTGG - Intronic
970398908 4:15699536-15699558 CTCTTTCTGTTCCCAGTTTCAGG - Intronic
971238246 4:24863354-24863376 TGATTCCTATTTCCAGTGTCTGG - Intronic
971289730 4:25326169-25326191 TTCTTGCTTTTTCCAGCGTCTGG + Intronic
971701709 4:29985342-29985364 ATCTTCCAGTTTCCATTGTCAGG + Intergenic
972248384 4:37271750-37271772 TTTTTCCTGTTTCCAATCTCTGG + Intronic
972447757 4:39162035-39162057 TGCTTCCTGTCATCACTGTCTGG + Intergenic
978178655 4:105766169-105766191 TTCCTGCTGTTACCATTCTCTGG - Intronic
979224490 4:118268780-118268802 TTCTACCTGTAACCTGTTTCTGG - Intergenic
980966268 4:139524413-139524435 TTCCTGCTCTTGCCAGTGTCTGG - Intronic
981042588 4:140237091-140237113 TTCTTCCTGCTGCCTGTGTTTGG - Intergenic
983106071 4:163687704-163687726 TTCTTCCTGTCACCAGAGAGAGG - Intronic
984398718 4:179233600-179233622 TTCTGCCTATTACAAGTTTCAGG - Intergenic
984467482 4:180119073-180119095 TTCTTTTTGTTCCCAGTTTCAGG + Intergenic
984503439 4:180587693-180587715 TTCTTCGTCTTCCCAGGGTCAGG - Intergenic
985469769 5:32945-32967 TTGTTTCTTTTTCCAGTGTCAGG + Intergenic
985500065 5:237638-237660 TTCTTCCCGTTACCTTTCTCTGG + Intronic
985737330 5:1592070-1592092 TTCTTCCCGTTACCTTTCTCTGG - Intergenic
986784104 5:11095844-11095866 TTCTTCCTGTTTTCTGTGCCTGG + Intronic
988423263 5:31032305-31032327 ATCTTCTTTATACCAGTGTCTGG - Intergenic
988964898 5:36406103-36406125 TTCTTCCTCTTCCCATTGTCTGG + Intergenic
989400258 5:41000767-41000789 TTCTTCCTGTTAGGGGTGCCAGG + Exonic
992737254 5:79734904-79734926 TTCTTCCAGAAACCAGTGTCTGG + Exonic
995365696 5:111357544-111357566 TTCGTCCTGTTTACAGTGACTGG - Intronic
995410166 5:111848156-111848178 TTCTTCTTGTCACCAGTATTTGG - Intronic
998997679 5:147883354-147883376 TTCCTCCTGTTGTCAGTTTCTGG + Intronic
999186868 5:149717690-149717712 TGCTTGCTTTTTCCAGTGTCTGG + Intergenic
1002008924 5:176260900-176260922 TTCTTCCTGTCACCAGCTTCTGG - Intronic
1002217800 5:177651372-177651394 TTCTTCCTGTCACCAGCTTCTGG + Intergenic
1004867355 6:19867458-19867480 TGCTTGCTGTTTCCAGTATCAGG + Intergenic
1005722639 6:28617894-28617916 TTCTTCCTGTAAGCAGTTACAGG - Intergenic
1006205616 6:32339369-32339391 TTCTCTCTTTTACCAGTGTGAGG - Intronic
1007969237 6:46034070-46034092 TTCTTCCTGTTACCAGTGTCTGG + Intronic
1008206832 6:48670384-48670406 TTCTTCCTGGAAGCAGTTTCTGG + Intergenic
1008276588 6:49550531-49550553 TTCTTCCTCCTACCCCTGTCCGG - Intergenic
1009824205 6:68845761-68845783 TTCTTTTTGTTCCCAGTTTCAGG + Intronic
1010622304 6:78091513-78091535 TTATAACTGTTACTAGTGTCAGG + Intergenic
1011967489 6:93176962-93176984 TCCATCCTCTTACCAGTGTCTGG + Intergenic
1012029420 6:94038766-94038788 TTCTTCCTTTTACTTGTGTAGGG + Intergenic
1012826480 6:104152536-104152558 CTCTTTTTGTTACCAGTTTCAGG - Intergenic
1015249131 6:131108241-131108263 CTCTTTCTGTTCCCAGTTTCAGG - Intergenic
1015391503 6:132687364-132687386 TTCTTGTTGTTAACAGTTTCCGG - Intronic
1016000948 6:139040620-139040642 TTCTACCTGTAATCAGTGACAGG + Intronic
1017121156 6:151025112-151025134 TTCTTCCATTTCCCAGAGTCCGG + Intronic
1017444874 6:154498631-154498653 TGATTCCTGTTACAAGTCTCAGG + Intronic
1017965007 6:159256501-159256523 TTTTTCCTGTTTCCATTTTCAGG + Exonic
1020363804 7:7358063-7358085 TTCTCCCTATTACCACTTTCAGG + Exonic
1021031479 7:15742412-15742434 TTCTACCAATTACAAGTGTCAGG + Intergenic
1021807226 7:24369393-24369415 TTTTTCTTATAACCAGTGTCAGG - Intergenic
1022691878 7:32664048-32664070 TTCTGCCTGTGGCCAGAGTCCGG - Intergenic
1022919540 7:34998589-34998611 TTCTGCCTGTGGCCAGAGTCCGG - Intronic
1023899614 7:44465662-44465684 TGGCTGCTGTTACCAGTGTCTGG - Intronic
1024960642 7:54971073-54971095 TTTTTCCAGTCAGCAGTGTCAGG + Intergenic
1026637064 7:72093379-72093401 TTCTCCCTGGTACGAGTGTACGG - Intronic
1027876620 7:83778495-83778517 TTGTTCATGTTACCACTGTTTGG - Intergenic
1028942329 7:96536242-96536264 ATCTTTCTGTTACCGGTTTCTGG + Intronic
1029170102 7:98624530-98624552 TACTTGCTGTCACCTGTGTCTGG + Intronic
1030531364 7:110714976-110714998 TTCTTCCTGTTTTCAATTTCGGG + Intronic
1031230506 7:119099932-119099954 TTCTTCCTCTTGCCTATGTCAGG + Intergenic
1031885724 7:127244182-127244204 ATATTCCTATTACCATTGTCAGG + Intronic
1033456211 7:141506337-141506359 TTCTTTTTGTTACCAGTTTTGGG - Intergenic
1033834986 7:145299787-145299809 TTCTTTTTGTTCCCAGTCTCAGG - Intergenic
1034395680 7:150823087-150823109 TTCTTCCTGTATCCAGTCTCTGG - Intergenic
1038752835 8:30312862-30312884 CTCTTCTTGTTACCAGTTTCAGG + Intergenic
1039182455 8:34881066-34881088 TTTTTCTTGCTCCCAGTGTCTGG - Intergenic
1040468080 8:47713749-47713771 TTCTTTATGTATCCAGTGTCTGG - Intronic
1041152367 8:54948615-54948637 TTCTTTCTGTTTCCACTGGCTGG - Intergenic
1041237457 8:55818865-55818887 GTCTTCATGTTTCCAGTATCTGG + Intronic
1041588737 8:59550870-59550892 TTCTTGCTTTTTCCAGTCTCTGG + Intergenic
1042697825 8:71577149-71577171 TTCTTCATGTTTCCTGTGTTTGG + Intronic
1044187172 8:89267668-89267690 TTCTCCATCTTACCAGAGTCGGG + Intergenic
1044440511 8:92218547-92218569 ATCTTCCTGATACCAATGCCTGG - Intergenic
1049413271 8:142483305-142483327 TTCAGCATGTGACCAGTGTCAGG - Intronic
1049965850 9:778699-778721 TTCTCCCTTCTACCAGTGTTGGG - Intergenic
1051345283 9:16145678-16145700 CTCTTCCTGTAACCAGTCTGTGG - Intergenic
1051453935 9:17230709-17230731 TCCTTCCTGTTTCCAGTATGTGG - Intronic
1051627615 9:19113371-19113393 GCCTTCCTGTTCCCAGTGACTGG - Intronic
1054828237 9:69594868-69594890 TTGTTACTGTTACTAGTGTTAGG + Intronic
1057431559 9:94999461-94999483 TTCTTCCTGGTATCAGCATCAGG - Intronic
1060752929 9:126185986-126186008 TTCTTGCTATTGCCAATGTCTGG - Intergenic
1186593213 X:10953152-10953174 TTCACCCTGTTGCCAGTGGCAGG - Intergenic
1187984570 X:24796449-24796471 TTCTTTCTGTTACTATTGGCAGG - Intronic
1188762260 X:34047424-34047446 CTCTACCTATTATCAGTGTCTGG - Intergenic
1189030800 X:37448058-37448080 TTGGTTCTGTTACCAGTGTAGGG + Intronic
1189126464 X:38452705-38452727 TTATTCCTCTTGCTAGTGTCAGG - Intronic
1189569379 X:42279073-42279095 TACTTTCTGTTGGCAGTGTCTGG - Intergenic
1189675984 X:43461026-43461048 TTCCCCCTGTTCCCAGTCTCTGG - Intergenic
1190049695 X:47140550-47140572 TTCTTCCTGTAGCCAGTGGCTGG + Intergenic
1190591326 X:52005195-52005217 TTTTTCCTGTTACTAATTTCTGG + Intergenic
1192432173 X:71119740-71119762 GGCTTCCTGCGACCAGTGTCAGG - Exonic
1193628915 X:83856545-83856567 TTCCACCTGTTACTAGTTTCTGG + Intergenic
1194264683 X:91739546-91739568 TTCTTTTTGTTACCAGTTTCAGG + Intergenic
1197894158 X:131292998-131293020 TGCTTCCAGATACCAGTGCCAGG + Intronic
1199334484 X:146602162-146602184 TTCTTCTTGTAACCAGTCTCAGG + Intergenic