ID: 1007970588

View in Genome Browser
Species Human (GRCh38)
Location 6:46048403-46048425
Sequence TCCCATGCTAAGACTGGGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 120}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007970588 Original CRISPR TCCCATGCTAAGACTGGGTT AGG (reversed) Intronic
902215627 1:14932622-14932644 TCCCAAGCTAAGACGGGCCTTGG - Intronic
903122890 1:21227843-21227865 TCACATGGTGAGACTGGCTTAGG + Intronic
904855681 1:33496709-33496731 CCCCATGCCAAGACTGAGGTGGG + Intergenic
905280637 1:36846821-36846843 TCCCATGCAAGGACTGGCCTAGG - Intronic
905504419 1:38465745-38465767 ATCCATGCTAATACTGGGGTCGG - Intergenic
909948388 1:81689910-81689932 TCTCATCCAAAGACTGGGTCTGG - Intronic
915447695 1:155983469-155983491 TCCCATCCTGAGCCTGGATTAGG - Intronic
915536174 1:156537144-156537166 TCCCATGCGTAGGCTGGGGTGGG + Intronic
916164228 1:161950712-161950734 GCCCATGAGAAGACTGGGTTGGG - Intronic
916415898 1:164591702-164591724 TGCCATACAAAGCCTGGGTTAGG - Intronic
916549223 1:165833328-165833350 TGCCATGCCAAGAGTGGGTCTGG - Intronic
917528885 1:175815255-175815277 TCCCATCCTGAGGCTGGGTTGGG - Intergenic
918679611 1:187335677-187335699 TCTCAAGATTAGACTGGGTTTGG - Intergenic
919618304 1:199835063-199835085 TCCCATGTGAACCCTGGGTTGGG - Intergenic
920419192 1:205818998-205819020 TCCCATGATCCTACTGGGTTGGG + Intergenic
920506321 1:206517888-206517910 TCCCATGCTAAGCCCAGGGTGGG - Intronic
924588208 1:245378401-245378423 TCCCAGGCAAAGCTTGGGTTGGG + Intronic
1065704608 10:28460522-28460544 TGCCATGCTAAGCCGGGGATGGG + Intergenic
1066028221 10:31387307-31387329 TCCTAACCTAAGACTGGTTTTGG + Intronic
1073251305 10:102121515-102121537 TCCCCTCCTAGGGCTGGGTTGGG - Intergenic
1074684294 10:115945322-115945344 TCACATTCTCAGACTGAGTTTGG - Exonic
1085826866 11:79857447-79857469 TCTAATGCTTAAACTGGGTTTGG - Intergenic
1089662051 11:119992145-119992167 TCCCAGGCCAGGACAGGGTTAGG + Intergenic
1093307824 12:17541583-17541605 TTCTAGGCTAAGAATGGGTTTGG - Intergenic
1094642588 12:32290581-32290603 TTCCTTGCTAAGGCTGGGCTGGG - Intronic
1096427311 12:51515002-51515024 TCCAATGCTGAAACTGGGTTAGG - Exonic
1100337261 12:93642896-93642918 TCCTTTGAGAAGACTGGGTTAGG + Intergenic
1103941567 12:124504045-124504067 TCCCACGCTGAGTCTGGGTTTGG - Intronic
1104312997 12:127671181-127671203 TCCCAGGCCAAGACTGGGCATGG + Intergenic
1105554718 13:21435838-21435860 TCAGATGCTAAGACAGAGTTTGG + Intronic
1108048228 13:46403546-46403568 TCCTATGATAAGACTTGGTGGGG + Intronic
1109369305 13:61400462-61400484 TCTCATGCTCAGATTGGGATGGG - Intergenic
1110316807 13:74117756-74117778 TCTCATGGTTAGACTGGCTTAGG - Intronic
1113209175 13:107955293-107955315 TCCAATGCTCATTCTGGGTTAGG + Intergenic
1115023695 14:28714715-28714737 TCCAATGCTGAGAGTGGGATGGG - Intergenic
1116295285 14:43099983-43100005 TCCCATGAAAAGAGTAGGTTGGG + Intergenic
1116450869 14:45063870-45063892 TACCTTGCTAAGACTGGGTTAGG - Intronic
1119861555 14:77939761-77939783 TCTCATGATTAGACTGGGTTAGG + Intergenic
1122128237 14:99590702-99590724 TCCCCTGCTAGGACTTGGCTGGG - Intronic
1124398787 15:29330496-29330518 TCTCATGATTAGACTGGATTTGG - Intronic
1124813829 15:32968680-32968702 TCACATGCTGAGAATGGGATAGG + Intronic
1128896904 15:71383009-71383031 TCCCATCCTAACAAGGGGTTGGG + Intronic
1129355297 15:74986881-74986903 TCTCATGATTAGACTGAGTTTGG + Intronic
1129454896 15:75671458-75671480 TCCCCTGCTGAGGCTGTGTTTGG + Intergenic
1132028843 15:98424324-98424346 TCCTATGCTCTGACTGGCTTAGG + Intergenic
1132147808 15:99438624-99438646 TTCCGTGGAAAGACTGGGTTCGG - Intergenic
1136187595 16:28597235-28597257 TCCAAAGCCACGACTGGGTTTGG + Intergenic
1137222753 16:46472105-46472127 CCCCCTGCTGAGACTGGGATAGG + Intergenic
1144103753 17:11967395-11967417 TACCATTCTAAGACTGGGCATGG - Intronic
1145858277 17:28183617-28183639 TCACAGGCTAAGGCTGGGTGCGG - Intronic
1146728791 17:35176476-35176498 TCTGATGTTAAGATTGGGTTTGG + Intronic
1147560498 17:41505899-41505921 TCCCGTTCTAATACTGGGTGGGG - Intergenic
1147758239 17:42782016-42782038 TCCCATGCTACATATGGGTTAGG + Intronic
1150018966 17:61591104-61591126 TCCCAGGCTGAGACAGGGTCTGG - Exonic
1151000604 17:70370906-70370928 TCCCATGGTTAGCCTGGTTTAGG + Intergenic
1155197177 18:23486154-23486176 TCCCATGCTGAGACAGGAATTGG - Intronic
1157102717 18:44744661-44744683 ACTCATGCAAAGACTGCGTTTGG - Intronic
1158670626 18:59470521-59470543 TCTCATGCTGAGAAGGGGTTGGG + Intronic
1158882023 18:61789445-61789467 TCCCACACTAACTCTGGGTTTGG - Intergenic
1158933323 18:62342108-62342130 TCCCATGTGCAGACTGGGTGTGG + Intronic
1159079345 18:63719302-63719324 TCACATGCTAGGATTGTGTTAGG + Intronic
1160393320 18:78553830-78553852 TCACAGGCTAAGACTGTGTTTGG - Intergenic
1161970322 19:7575618-7575640 TCCCATGCTGACTCAGGGTTTGG - Intergenic
1166917644 19:46206416-46206438 TCGTATGCTGAGACTGGGTGTGG - Intergenic
1168664930 19:58196974-58196996 TCTCAAGATAAGACTGAGTTAGG - Intronic
926232155 2:11012433-11012455 ACCCATGCTGAGACTGGGAGAGG + Intergenic
927124137 2:19997941-19997963 TCCCATGTTCAGACTGGCCTAGG + Intronic
943370519 2:187010415-187010437 TTTCTTGCTAAGACTGGGCTGGG + Intergenic
944659302 2:201907545-201907567 TTCCATGCTCAGAATGGTTTTGG - Intergenic
947759810 2:232595745-232595767 TCTCATGATTAGACTGGGGTTGG - Intergenic
948268581 2:236656780-236656802 TCCCATGGGAAGATTGGATTAGG + Intergenic
1168816263 20:739393-739415 TCCCATTCTAAGAGGGTGTTTGG - Intergenic
1169774581 20:9238493-9238515 TCAAATGATAAGACTGGATTTGG - Intronic
1172927986 20:38557905-38557927 TTGCATGGTAAGACTGTGTTTGG + Intronic
1172947496 20:38700675-38700697 TCCTCTGCTCAGACTGTGTTTGG + Intergenic
1174370946 20:50087103-50087125 CCCCAAGCTAAGGCTGGGTGCGG + Intronic
1180850415 22:19016499-19016521 TCCTATGCACAGACTGGGCTGGG + Intergenic
956188607 3:66586372-66586394 TCCAAAGATGAGACTGGGTTAGG + Intergenic
961641468 3:128367368-128367390 TCCCAAGCCCAGACTCGGTTGGG - Intronic
962496793 3:135947981-135948003 TCTCATGATAAGACTGAGTATGG + Intergenic
966321406 3:178705134-178705156 TCCCAGGATATGACTGGTTTAGG - Intronic
967717586 3:192780602-192780624 TCCCTTGGGAAGGCTGGGTTAGG + Intergenic
971362458 4:25950647-25950669 CTCCCTGCTAAGCCTGGGTTTGG - Intergenic
971911026 4:32798126-32798148 TGCCATGGCAACACTGGGTTGGG + Intergenic
980650081 4:135702068-135702090 TCCCATCCTGAGCCTGAGTTTGG + Intergenic
981925537 4:150135614-150135636 TTCCCTGCTAAGTGTGGGTTAGG - Intronic
985535087 5:460144-460166 TCCGATGCCAAGTCTGCGTTTGG + Intronic
986300701 5:6476405-6476427 TCCCATTTTAAGAATGTGTTTGG + Intronic
991967373 5:72106978-72107000 TCCCATGCACAGACAGGGTGAGG + Intergenic
994254131 5:97572464-97572486 TCCCATGTTGACACTGGATTTGG - Intergenic
995038867 5:107566026-107566048 CCCCTTGCTGAGACAGGGTTGGG - Intronic
995370491 5:111413097-111413119 TCCCAAGCTAAGCCTCAGTTTGG + Intronic
1002976108 6:2078842-2078864 TCTCATGCTGAGAATGGGGTTGG + Intronic
1003054951 6:2809795-2809817 ACCCTTGCTAAGACTGGCCTGGG - Intergenic
1007970588 6:46048403-46048425 TCCCATGCTAAGACTGGGTTAGG - Intronic
1012958363 6:105595058-105595080 CTCCATCTTAAGACTGGGTTAGG - Intergenic
1013371567 6:109475303-109475325 TGCCCTGCTAAGCCTGTGTTTGG - Intronic
1023119357 7:36893781-36893803 TCCCATGCAAAGGCTAGGATAGG - Intronic
1023822590 7:43988319-43988341 TCCCATGTTAAGTCTGGATCTGG - Intergenic
1026406838 7:70074700-70074722 TGCCATGATGAGACAGGGTTGGG - Intronic
1028260432 7:88657862-88657884 TCCGATGCTTAAACTGTGTTGGG + Intergenic
1029750852 7:102541734-102541756 TCCCATGTTAAGTCTGGATCTGG - Intronic
1029768806 7:102640845-102640867 TCCCATGTTAAGTCTGGATCTGG - Intronic
1033448667 7:141443520-141443542 TCTCACGATTAGACTGGGTTAGG + Intronic
1034355584 7:150448617-150448639 CCCCATCCTCAGACTGAGTTAGG + Intergenic
1034412530 7:150948689-150948711 CCCCAGGCAAAGACTGAGTTTGG + Intronic
1034991850 7:155552641-155552663 TCCCAAGCTGAGAGTGGGCTGGG - Intergenic
1035812027 8:2500556-2500578 TCCTATTCTCAGACTGGATTGGG + Intergenic
1040404865 8:47089719-47089741 TGCCATGCTAAGACTGGAACTGG - Intergenic
1041671180 8:60493376-60493398 TTCCATGTTGACACTGGGTTTGG + Intergenic
1045251781 8:100488684-100488706 TCCTATGGTAAGACTATGTTTGG - Intergenic
1045818905 8:106311804-106311826 TTCAATGCTAAGAATGGGTAGGG - Intronic
1048305882 8:133284503-133284525 CCCAATGGGAAGACTGGGTTGGG - Intronic
1049508042 8:143014233-143014255 TCCCCTGGCAGGACTGGGTTAGG - Intergenic
1053490567 9:38498089-38498111 TCCCATGCTGAGGCTGTCTTGGG - Intergenic
1056383733 9:86078550-86078572 TCCTTTGCTAGGACTGGGCTGGG + Intronic
1057670890 9:97087342-97087364 TCCCATGCTAAGGCTGTCTTGGG - Intergenic
1058424729 9:104866442-104866464 TCCCATCCTCAAGCTGGGTTAGG + Intronic
1059913637 9:119074751-119074773 TCCTATTCTAAGTCTGGGTGAGG + Intergenic
1060701286 9:125750899-125750921 TCTCATTCTAAGACTAGTTTTGG - Intronic
1060765497 9:126292912-126292934 GCCCTTGCTAAGCCTGGCTTGGG + Intergenic
1061759019 9:132837011-132837033 TCCCATTCTTAGGCTGAGTTTGG - Intronic
1061886554 9:133593880-133593902 TCCCTTCCTAAGTCTGGGCTGGG + Intergenic
1187396824 X:18926698-18926720 TTCCATGCAATGACTGGCTTTGG + Intronic
1191129506 X:56993275-56993297 TCACAGGCAAAGGCTGGGTTTGG - Intronic
1193236415 X:79113024-79113046 TCCCATGAGAAAACTGGGGTAGG - Intergenic
1194807823 X:98351199-98351221 GCCCATGCAAAGACTGAGGTGGG + Intergenic
1196366893 X:114933578-114933600 TCCAATGCTGAAACTGGGTTAGG + Intergenic
1199401638 X:147405626-147405648 GACAGTGCTAAGACTGGGTTTGG + Intergenic
1199900211 X:152165598-152165620 TCCCATGCTAGAACTGGAGTTGG + Intergenic