ID: 1007974035

View in Genome Browser
Species Human (GRCh38)
Location 6:46082380-46082402
Sequence CTGACTTACATTTTAACGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007974035_1007974038 11 Left 1007974035 6:46082380-46082402 CCTTCCGTTAAAATGTAAGTCAG No data
Right 1007974038 6:46082414-46082436 CTGTGCTCAAACCCCTACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007974035 Original CRISPR CTGACTTACATTTTAACGGA AGG (reversed) Intergenic
No off target data available for this crispr