ID: 1007975654

View in Genome Browser
Species Human (GRCh38)
Location 6:46098763-46098785
Sequence ATTGACTGGGTGGTGACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007975654_1007975662 10 Left 1007975654 6:46098763-46098785 CCAGGTGTCACCACCCAGTCAAT No data
Right 1007975662 6:46098796-46098818 AAGAGTCTGAGGGCAGTGGAGGG No data
1007975654_1007975660 6 Left 1007975654 6:46098763-46098785 CCAGGTGTCACCACCCAGTCAAT No data
Right 1007975660 6:46098792-46098814 GTCAAAGAGTCTGAGGGCAGTGG No data
1007975654_1007975661 9 Left 1007975654 6:46098763-46098785 CCAGGTGTCACCACCCAGTCAAT No data
Right 1007975661 6:46098795-46098817 AAAGAGTCTGAGGGCAGTGGAGG No data
1007975654_1007975658 -1 Left 1007975654 6:46098763-46098785 CCAGGTGTCACCACCCAGTCAAT No data
Right 1007975658 6:46098785-46098807 TCAGAAAGTCAAAGAGTCTGAGG No data
1007975654_1007975663 13 Left 1007975654 6:46098763-46098785 CCAGGTGTCACCACCCAGTCAAT No data
Right 1007975663 6:46098799-46098821 AGTCTGAGGGCAGTGGAGGGAGG No data
1007975654_1007975664 23 Left 1007975654 6:46098763-46098785 CCAGGTGTCACCACCCAGTCAAT No data
Right 1007975664 6:46098809-46098831 CAGTGGAGGGAGGTTGTGCCTGG No data
1007975654_1007975659 0 Left 1007975654 6:46098763-46098785 CCAGGTGTCACCACCCAGTCAAT No data
Right 1007975659 6:46098786-46098808 CAGAAAGTCAAAGAGTCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007975654 Original CRISPR ATTGACTGGGTGGTGACACC TGG (reversed) Intergenic