ID: 1007975834

View in Genome Browser
Species Human (GRCh38)
Location 6:46100405-46100427
Sequence CAGCTCCCTGACTTTGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007975830_1007975834 -8 Left 1007975830 6:46100390-46100412 CCCTTTGTTATCCAGCAGCTCCC No data
Right 1007975834 6:46100405-46100427 CAGCTCCCTGACTTTGCCCTGGG No data
1007975831_1007975834 -9 Left 1007975831 6:46100391-46100413 CCTTTGTTATCCAGCAGCTCCCT No data
Right 1007975834 6:46100405-46100427 CAGCTCCCTGACTTTGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007975834 Original CRISPR CAGCTCCCTGACTTTGCCCT GGG Intergenic
No off target data available for this crispr