ID: 1007976140

View in Genome Browser
Species Human (GRCh38)
Location 6:46103403-46103425
Sequence CAATCTGCACTGATGCAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007976139_1007976140 7 Left 1007976139 6:46103373-46103395 CCTTTCGTAGGGGACATTTACAT No data
Right 1007976140 6:46103403-46103425 CAATCTGCACTGATGCAGCTAGG No data
1007976135_1007976140 19 Left 1007976135 6:46103361-46103383 CCTGCAAAGCTGCCTTTCGTAGG No data
Right 1007976140 6:46103403-46103425 CAATCTGCACTGATGCAGCTAGG No data
1007976134_1007976140 20 Left 1007976134 6:46103360-46103382 CCCTGCAAAGCTGCCTTTCGTAG No data
Right 1007976140 6:46103403-46103425 CAATCTGCACTGATGCAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007976140 Original CRISPR CAATCTGCACTGATGCAGCT AGG Intergenic
No off target data available for this crispr