ID: 1007983163

View in Genome Browser
Species Human (GRCh38)
Location 6:46179891-46179913
Sequence AAGAGTGAGGACAAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007983158_1007983163 -3 Left 1007983158 6:46179871-46179893 CCTGGAAGGACCAGAATGGGAAG No data
Right 1007983163 6:46179891-46179913 AAGAGTGAGGACAAGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007983163 Original CRISPR AAGAGTGAGGACAAGGAGGC AGG Intergenic
No off target data available for this crispr