ID: 1007983285

View in Genome Browser
Species Human (GRCh38)
Location 6:46180826-46180848
Sequence CTGCTTTTCTTGAGGGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007983273_1007983285 28 Left 1007983273 6:46180775-46180797 CCTCATGCCAGTGGATCAGAAGG No data
Right 1007983285 6:46180826-46180848 CTGCTTTTCTTGAGGGGAGAGGG No data
1007983276_1007983285 21 Left 1007983276 6:46180782-46180804 CCAGTGGATCAGAAGGGAGTTAT No data
Right 1007983285 6:46180826-46180848 CTGCTTTTCTTGAGGGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007983285 Original CRISPR CTGCTTTTCTTGAGGGGAGA GGG Intergenic
No off target data available for this crispr