ID: 1007984214

View in Genome Browser
Species Human (GRCh38)
Location 6:46191132-46191154
Sequence CTGTTGGCCTTGAGGGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007984210_1007984214 -2 Left 1007984210 6:46191111-46191133 CCGAGACTGAAGGAACTGTGACT No data
Right 1007984214 6:46191132-46191154 CTGTTGGCCTTGAGGGAACAAGG No data
1007984206_1007984214 8 Left 1007984206 6:46191101-46191123 CCCACAGGTCCCGAGACTGAAGG No data
Right 1007984214 6:46191132-46191154 CTGTTGGCCTTGAGGGAACAAGG No data
1007984208_1007984214 7 Left 1007984208 6:46191102-46191124 CCACAGGTCCCGAGACTGAAGGA No data
Right 1007984214 6:46191132-46191154 CTGTTGGCCTTGAGGGAACAAGG No data
1007984202_1007984214 21 Left 1007984202 6:46191088-46191110 CCTGTCCCCAGCACCCACAGGTC No data
Right 1007984214 6:46191132-46191154 CTGTTGGCCTTGAGGGAACAAGG No data
1007984209_1007984214 -1 Left 1007984209 6:46191110-46191132 CCCGAGACTGAAGGAACTGTGAC No data
Right 1007984214 6:46191132-46191154 CTGTTGGCCTTGAGGGAACAAGG No data
1007984204_1007984214 15 Left 1007984204 6:46191094-46191116 CCCAGCACCCACAGGTCCCGAGA No data
Right 1007984214 6:46191132-46191154 CTGTTGGCCTTGAGGGAACAAGG No data
1007984205_1007984214 14 Left 1007984205 6:46191095-46191117 CCAGCACCCACAGGTCCCGAGAC No data
Right 1007984214 6:46191132-46191154 CTGTTGGCCTTGAGGGAACAAGG No data
1007984203_1007984214 16 Left 1007984203 6:46191093-46191115 CCCCAGCACCCACAGGTCCCGAG No data
Right 1007984214 6:46191132-46191154 CTGTTGGCCTTGAGGGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007984214 Original CRISPR CTGTTGGCCTTGAGGGAACA AGG Intergenic
No off target data available for this crispr