ID: 1007985998

View in Genome Browser
Species Human (GRCh38)
Location 6:46207181-46207203
Sequence ATGTGGGTCACTTTTTTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 467
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 426}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007985998 Original CRISPR ATGTGGGTCACTTTTTTTTT TGG (reversed) Intergenic
906160347 1:43644124-43644146 CTGTAGTTAACTTTTTTTTTTGG + Intergenic
907117299 1:51980043-51980065 ATGTCAGTTAATTTTTTTTTTGG - Intronic
908078404 1:60546283-60546305 CTGTGGGAGACTTTTCTTTTGGG - Intergenic
908305126 1:62806353-62806375 AGTTAGGTCATTTTTTTTTTTGG + Intronic
909243353 1:73243511-73243533 ATCTGGTCCAATTTTTTTTTTGG - Intergenic
910023296 1:82619409-82619431 ATGTGGTTCAGTTATTTTGTAGG - Intergenic
910510780 1:88001707-88001729 ATGTGGGTCAATTTTATTTTGGG + Intergenic
911055843 1:93707905-93707927 ATGTGGGTCATCTGTTGTTTAGG - Intronic
912149432 1:106839467-106839489 ATGTGGGATAATTTTTTTCTTGG - Intergenic
915408532 1:155681588-155681610 CTGTCTGTCTCTTTTTTTTTTGG - Intronic
915968126 1:160330126-160330148 ATCAGGGGCAATTTTTTTTTGGG - Intronic
916531596 1:165661546-165661568 ACGTGGGTTTTTTTTTTTTTTGG - Intronic
916812876 1:168321009-168321031 CTGTCTCTCACTTTTTTTTTTGG + Intergenic
916921367 1:169471059-169471081 CTGTGGGTTTTTTTTTTTTTTGG - Intronic
918556860 1:185812137-185812159 ATGTTGTTGATTTTTTTTTTAGG + Intronic
918798781 1:188942804-188942826 ATGTGGGTCACTTTTACTACAGG + Intergenic
919222022 1:194641691-194641713 ATGTGTGTGACTTTGTTTTGGGG + Intergenic
919438660 1:197598052-197598074 ATGTGGCTCACATTTTATTTTGG + Intronic
919534349 1:198768220-198768242 TTGAGAGTCATTTTTTTTTTTGG + Intergenic
920013282 1:202885962-202885984 AGGTGGGTTTTTTTTTTTTTGGG - Intronic
920542534 1:206790337-206790359 ATGGGGCTCAGTTTTTTTTCTGG - Intergenic
920810206 1:209278400-209278422 ATATGGGTCACATTTTGATTTGG - Intergenic
921434868 1:215106895-215106917 AGGTGTGTCACTTTATTTCTGGG + Intronic
922460176 1:225809827-225809849 ATGTATGTCCTTTTTTTTTTTGG - Intergenic
923012937 1:230103511-230103533 ATGTAAGTCACCTTTTTTTCTGG + Intronic
924737554 1:246771991-246772013 ATTTTTTTCACTTTTTTTTTAGG - Intergenic
1064668069 10:17678250-17678272 ATGTGGTGTAATTTTTTTTTTGG + Intronic
1064863555 10:19853831-19853853 ATGTGGATCAATTTCTTTTCTGG + Intronic
1065289345 10:24214501-24214523 ATGTGGGCCACCTTTTGTTGGGG - Intronic
1065996517 10:31064292-31064314 ATTTGGATCCCTTTTCTTTTGGG + Intergenic
1066278266 10:33889710-33889732 ATGAGGGACACATTTTTTCTGGG + Intergenic
1066318081 10:34269233-34269255 AGATGGATCACTTTTTTTTTAGG - Intronic
1067069699 10:43122598-43122620 ATGTGCCTCTCTTTTTTTGTGGG + Intronic
1067076649 10:43191005-43191027 ATGTGGGTTTGTTTTTTTTCTGG + Intergenic
1067680014 10:48428261-48428283 ATGTGGGTCAGGTAATTTTTAGG + Intronic
1067844431 10:49708712-49708734 ATGTGGGACAATTTTTGTTTTGG - Exonic
1068003285 10:51362394-51362416 ATGTGAGTCTTCTTTTTTTTTGG + Intronic
1068999572 10:63248316-63248338 ATGTTGGTTGCTTTTTCTTTGGG - Intronic
1069451444 10:68521132-68521154 CTGTGTGTTCCTTTTTTTTTTGG - Intronic
1070235147 10:74616537-74616559 ATATGGGTGAGTCTTTTTTTAGG + Intronic
1070422928 10:76255266-76255288 TTGTGAGTCACTTTTAATTTTGG - Intronic
1070627998 10:78064726-78064748 ATCTGGCTAATTTTTTTTTTTGG + Intergenic
1071792448 10:88969566-88969588 ATCAAGATCACTTTTTTTTTTGG + Intronic
1071971321 10:90910635-90910657 AAGTGAGTCACAATTTTTTTTGG - Intergenic
1072270429 10:93771092-93771114 ATGTCTGGCACATTTTTTTTTGG - Intronic
1072624803 10:97104393-97104415 ATGTAGGTCACTCTTCTGTTTGG - Intronic
1073455129 10:103632163-103632185 ATGTGGTTGGTTTTTTTTTTAGG - Intronic
1075024172 10:118971736-118971758 ATGTGAGTCATTTTAATTTTGGG - Intergenic
1075053522 10:119201069-119201091 AAGTTGGGCACTTTTTTGTTTGG - Intergenic
1075431985 10:122392872-122392894 ATTTGGATAACTATTTTTTTTGG + Intronic
1077667734 11:4129002-4129024 TTGTGGGTTTTTTTTTTTTTTGG + Intronic
1078217814 11:9326514-9326536 ATGTGTGTGGCTTTATTTTTGGG - Intergenic
1078815186 11:14813860-14813882 ATATGTGTAACTTTTTGTTTAGG - Intronic
1078893844 11:15580827-15580849 ATGTGAGTCACTTTCTTATAAGG - Intergenic
1078946574 11:16075063-16075085 AGGTGTGTGACTTTTTTTCTGGG - Intronic
1079545158 11:21624986-21625008 ATGTGGGTCACGCATTTTGTTGG + Intergenic
1080234087 11:30048760-30048782 TTGTGGGTTTTTTTTTTTTTTGG - Intergenic
1080338372 11:31226494-31226516 ATATTGATCACTTTTTTTTTTGG - Intronic
1080689881 11:34547665-34547687 ATGTAGGTGACTTTATTCTTTGG - Intergenic
1083093645 11:60226305-60226327 ATGTTTTTGACTTTTTTTTTTGG - Intronic
1083246575 11:61432958-61432980 ATGTAAGTCACTTTTAATTTTGG - Intronic
1084141337 11:67232218-67232240 CTTTGGGTCACTTTATTTTTGGG - Intronic
1085160322 11:74336903-74336925 TTGTGTGTAATTTTTTTTTTTGG - Intronic
1087592629 11:100210733-100210755 ATGGGGTTCACATTATTTTTTGG - Intronic
1088365913 11:109039715-109039737 CTGTGAGTCACTTTTTTTTTGGG + Intergenic
1089345063 11:117785741-117785763 ATGTGAGTCTCCTTTCTTTTGGG - Intronic
1089587216 11:119517892-119517914 ATCATGGTCACTTTTTTTTTTGG + Intergenic
1091561737 12:1619650-1619672 CTCTGTCTCACTTTTTTTTTTGG - Intronic
1091921228 12:4306501-4306523 ATGGGGGTAACTTTTTTCTTGGG + Intergenic
1092731273 12:11537361-11537383 ATGTTGGTAACCTTTTATTTAGG + Intergenic
1092809456 12:12258942-12258964 ATTTGGGTGACTATTTTCTTGGG + Intronic
1093130693 12:15388618-15388640 ATGTGGGTATTTTTTATTTTAGG + Intronic
1093486431 12:19657991-19658013 ATTTGGGGAATTTTTTTTTTTGG + Intronic
1094709370 12:32946110-32946132 ATATTGGTCTCTTTTTTTCTTGG - Intergenic
1095143206 12:38692316-38692338 TTGTGCCTTACTTTTTTTTTTGG - Intronic
1095384301 12:41632284-41632306 ATGTGGGTGGCTTTACTTTTGGG - Intergenic
1095436897 12:42199144-42199166 ATTTGGGTCATTCTCTTTTTTGG - Intronic
1095670533 12:44854797-44854819 ATTTAAGTAACTTTTTTTTTTGG - Intronic
1097216755 12:57419967-57419989 ATGTAGGAGACTTATTTTTTTGG - Intronic
1098040067 12:66345039-66345061 ATTTGAGTCTCTTTTTTTCTTGG + Exonic
1098070807 12:66672480-66672502 ATCTGGGTGCATTTTTTTTTTGG + Intronic
1099200480 12:79670853-79670875 ATGTTTGCCACTTTTTTTTTAGG + Intronic
1099395031 12:82127404-82127426 ATGTGTGTGACCTTCTTTTTGGG - Intergenic
1101554853 12:105799474-105799496 ATGTGGAACACTTTTCTCTTTGG + Intergenic
1103193190 12:119019958-119019980 ATGTGTGTGATTTTTTTTTGGGG - Intronic
1103522441 12:121545413-121545435 GTGAGCCTCACTTTTTTTTTTGG + Intronic
1106354304 13:28965035-28965057 ATGTGTGTCACTTTCCATTTTGG + Intronic
1107200555 13:37711774-37711796 ATATGGCTCACGTTTTATTTTGG - Intronic
1108675529 13:52734561-52734583 AGGTGGGTTTCTTTTTTTTTTGG + Intronic
1108723476 13:53156257-53156279 ATATAGGATACTTTTTTTTTAGG - Intergenic
1109019625 13:57071814-57071836 ATGTGGATAACTTTTTTTGCAGG + Intergenic
1109212697 13:59552393-59552415 ATTTGGGTCTTTTTTATTTTGGG - Intergenic
1109539555 13:63756053-63756075 CTGTGGGGCTTTTTTTTTTTTGG - Intergenic
1111110151 13:83696908-83696930 ATTTGGATTTCTTTTTTTTTTGG + Intergenic
1111728376 13:92041536-92041558 ATGAGTGTGACTTTATTTTTAGG - Intronic
1112167587 13:96936185-96936207 ATGTGGATAACTATTCTTTTAGG + Intergenic
1112348201 13:98610513-98610535 CTGTGGGTCACTTTTGCTTCTGG + Intergenic
1113279603 13:108774547-108774569 ATGTGATTGATTTTTTTTTTCGG + Intronic
1114378236 14:22172758-22172780 ATTTGTGTGACTTTTTTGTTGGG - Intergenic
1115201811 14:30861870-30861892 ATGTGTGTCAGTGTTTCTTTTGG - Intergenic
1115303376 14:31909773-31909795 AAGTGAGTCTCTTATTTTTTAGG + Intergenic
1116069754 14:40028762-40028784 ATCTGGGTCACTTTATATCTAGG + Intergenic
1116340720 14:43720289-43720311 ATGTAGGTCACTATGTTCTTTGG + Intergenic
1116526590 14:45913576-45913598 GTGTGAGTTACTTATTTTTTTGG + Intergenic
1116539751 14:46086574-46086596 ATGTGAGTCACATGTTTTTTTGG + Intergenic
1116748721 14:48853549-48853571 CTGTGGAACCCTTTTTTTTTTGG - Intergenic
1116922560 14:50595245-50595267 ATGTGGGTTAATTTTTTTGTGGG - Intronic
1117395848 14:55309558-55309580 GTGTGGGTAACTTTTGTTCTTGG - Intronic
1117412158 14:55460223-55460245 ATCTGGGTTTTTTTTTTTTTTGG - Intergenic
1118567219 14:67154921-67154943 CTGTGGTTCACTTTTTCTCTGGG - Intronic
1118837788 14:69488737-69488759 AATTTGGTCACTTTTTTTTCTGG - Intronic
1120261332 14:82189459-82189481 ATGTGGGTAAATCTTTGTTTGGG + Intergenic
1120895231 14:89524937-89524959 ATGAGGGTCTCTTGTTTTTGGGG - Intronic
1120922573 14:89768245-89768267 ATGTGGCTCATATTTATTTTAGG - Intergenic
1121077589 14:91082249-91082271 GTGTGGCTCACTTTTTATCTTGG - Intronic
1122090898 14:99339573-99339595 ATTTGAGTCACTGTTATTTTGGG - Intergenic
1122591893 14:102859192-102859214 ATGTGGATTTTTTTTTTTTTTGG - Intronic
1123464280 15:20503306-20503328 ATTTAGATGACTTTTTTTTTTGG + Intergenic
1124271043 15:28280910-28280932 GTGTTAGTAACTTTTTTTTTTGG - Intronic
1124307691 15:28592312-28592334 ATTTAGATGACTTTTTTTTTTGG - Intergenic
1125042874 15:35212212-35212234 CTGTGGACCACTTTTTTTTTTGG + Intergenic
1125349309 15:38751243-38751265 CTCTGGGTCACATTTATTTTAGG - Intergenic
1125676906 15:41506989-41507011 ATGTGGGCCAGATTTTTTCTGGG + Intronic
1125901244 15:43350059-43350081 ATAGGAGTCACTCTTTTTTTTGG + Intronic
1126039150 15:44573981-44574003 TTGTTGGACACTTATTTTTTTGG + Intronic
1126080293 15:44954412-44954434 TTGTGGTTCCCTTTTTCTTTAGG - Intergenic
1128743385 15:70097815-70097837 GTCCGGGGCACTTTTTTTTTTGG - Exonic
1130139032 15:81207837-81207859 ATGTGGGTTTTTTTTTTTTTTGG + Intronic
1130645764 15:85725362-85725384 ATGTGTGTCTCTGCTTTTTTGGG + Intronic
1131940228 15:97555550-97555572 ATTTGTGTCATTTTTTTCTTAGG + Intergenic
1132119306 15:99162921-99162943 ATCTGGCTAATTTTTTTTTTTGG - Intronic
1134259398 16:12638708-12638730 ATCTGGGACAGTTTTTTTCTGGG - Intergenic
1134751224 16:16626987-16627009 TTTTAGGTCACTTTTTTTCTGGG - Intergenic
1134994230 16:18726605-18726627 TTTTAGGTCACTTTTTTTCTGGG + Intergenic
1135777680 16:25271165-25271187 ACCTGGGTAATTTTTTTTTTTGG - Intergenic
1136144906 16:28310873-28310895 ATGTGCGCCACTTTTTTGCTGGG - Intronic
1136454324 16:30371704-30371726 ATGTGTGTTACTATTCTTTTGGG + Intronic
1137422556 16:48348020-48348042 TTGTTTGTGACTTTTTTTTTAGG + Intronic
1138071581 16:53997696-53997718 ATTTGGATCTTTTTTTTTTTAGG + Intronic
1139101761 16:63775978-63776000 AAGTGAGTAACTTTTCTTTTAGG + Intergenic
1139336862 16:66238688-66238710 ATGTGGGTGGATTTTCTTTTTGG - Intergenic
1140387825 16:74557745-74557767 CTGTGTGTCTTTTTTTTTTTTGG + Intronic
1141250668 16:82355256-82355278 ATGTGGGTCACATTGTAATTAGG + Intergenic
1141877922 16:86838843-86838865 ATGTGAGCCACTTGTATTTTAGG - Intergenic
1141959824 16:87397793-87397815 ATTTTGCTCATTTTTTTTTTTGG + Intronic
1142193472 16:88728550-88728572 TCGAGGGTCACTTTGTTTTTGGG - Intronic
1142193552 16:88728975-88728997 TCGAGGGTCACTTTGTTTTTGGG - Intronic
1142193571 16:88729060-88729082 TCGAGGGTCACTTTGTTTTTGGG - Intronic
1142193590 16:88729145-88729167 TCGAGGGTCACTTTGTTTTTGGG - Intronic
1142193609 16:88729230-88729252 TCGAGGGTCACTTTGTTTTTGGG - Intronic
1142193628 16:88729315-88729337 TCGAGGGTCACTTTGTTTTTGGG - Intronic
1142193647 16:88729400-88729422 TCGAGGGTCACTTTGTTTTTGGG - Intronic
1142193681 16:88729570-88729592 TCGAGGGTCACTTTGTTTTTGGG - Intronic
1142193701 16:88729656-88729678 TCGAGGGTCACTTTGTTTTTGGG - Intronic
1142193737 16:88729826-88729848 TCGAGGGTCACTTTGTTTTTGGG - Intronic
1142651945 17:1359306-1359328 CTGTGGGTAACTTTTTTTTCCGG - Intronic
1143440273 17:6966508-6966530 GTGTGGCTCTTTTTTTTTTTTGG - Intronic
1144197681 17:12911048-12911070 ATGTGGTTTTTTTTTTTTTTTGG - Intronic
1145256733 17:21328799-21328821 TGCCGGGTCACTTTTTTTTTAGG + Intergenic
1145711560 17:26983206-26983228 ATGTGGGTCACTTCCTTGTTTGG - Intergenic
1146108651 17:30066780-30066802 ATTTGGGTCTTTTTTTTTCTTGG - Intronic
1146524312 17:33553022-33553044 ATTTGAGTCACTTGTTCTTTGGG + Intronic
1147018170 17:37509086-37509108 ATATGGGTTTTTTTTTTTTTTGG - Intronic
1148294084 17:46484789-46484811 ATATGAGTCATATTTTTTTTAGG - Intergenic
1148316267 17:46702492-46702514 ATATGAGTCATATTTTTTTTAGG - Intronic
1148584536 17:48768092-48768114 AAGGGGGTCACTTTTTTTTTTGG + Intronic
1148724687 17:49780227-49780249 ATGTGGGTCTTTTTATTTGTTGG - Intronic
1151025828 17:70675329-70675351 ATGTGTGTTACTTTTTTGCTAGG - Intergenic
1152145946 17:78568957-78568979 AAGTGGGTCATTTTTATTCTTGG + Intronic
1156112933 18:33749200-33749222 ATGTGGGTCAGATATTTTATAGG + Exonic
1156162476 18:34375855-34375877 CTTTTGGTTACTTTTTTTTTTGG - Intergenic
1156252785 18:35367153-35367175 ATGTAGGATACTTTTTATTTGGG - Exonic
1156616268 18:38788691-38788713 AAGTGTTTCAATTTTTTTTTTGG - Intergenic
1157520941 18:48345061-48345083 ATCTGGGTTGCTTTATTTTTGGG - Intronic
1158034532 18:53009555-53009577 AGTTAGGTGACTTTTTTTTTAGG + Intronic
1159834448 18:73320337-73320359 ATGTCTGTCAGTTTTTTTATTGG - Intergenic
1163461668 19:17441707-17441729 ACATGGGGGACTTTTTTTTTTGG + Intronic
1163707993 19:18827750-18827772 ATGTGGTTTTTTTTTTTTTTTGG + Intergenic
1164041743 19:21498638-21498660 ATGTGGCTCTCCTTTTTTTCTGG + Intronic
1164255025 19:23520411-23520433 ATGTGATTCTCTTTATTTTTTGG - Intergenic
1165284308 19:34827188-34827210 ATGTAGGATACTTTTTATTTGGG + Intergenic
1166333302 19:42090964-42090986 TTGTGGGTTTTTTTTTTTTTTGG + Exonic
1167228908 19:48269229-48269251 ATGTGCATCTCTTTTTCTTTTGG - Intronic
1167977945 19:53246315-53246337 ATCATGGTCGCTTTTTTTTTGGG - Intronic
925633946 2:5924376-5924398 ATGTGGATCAGTTTAGTTTTGGG - Intergenic
925998076 2:9308038-9308060 ATCTAGGCCACTTTTGTTTTTGG - Intronic
926603583 2:14873686-14873708 GTGTGGGTTTTTTTTTTTTTTGG - Intergenic
926668887 2:15556029-15556051 AATTGTGTCACTTTTTTTGTGGG - Intronic
927268219 2:21177067-21177089 AGCTGGGTCATTTTTGTTTTAGG - Intergenic
927649658 2:24904617-24904639 AGCTGGGTCACCGTTTTTTTTGG - Intronic
927923366 2:26991251-26991273 GTTTGGATCTCTTTTTTTTTGGG - Intronic
929089392 2:38199893-38199915 ATGTGGGTCACATTTTGTCCTGG - Intergenic
929236853 2:39614607-39614629 ATGTTGGTTCATTTTTTTTTTGG + Intergenic
929938172 2:46310164-46310186 ATGAGGGTCACTGCTATTTTAGG - Intronic
930076978 2:47414024-47414046 ATTTGGGTAATTTTCTTTTTTGG + Intronic
930153583 2:48082320-48082342 ATGTGAGGCACATTTTTATTTGG - Intergenic
930403233 2:50918839-50918861 ATTTGGATCACATTTTTTTGGGG - Intronic
930654685 2:53996140-53996162 TTGTGAGTCTTTTTTTTTTTGGG - Intronic
930755377 2:54967590-54967612 ATGGGGGTAACTTGTGTTTTTGG + Intronic
931549688 2:63429001-63429023 AGGTGTGTGACTTTTTTTCTGGG - Intronic
931812789 2:65870903-65870925 ATGTGGGTCCCTTTCATTTGGGG - Intergenic
931841296 2:66152052-66152074 ATTTGGGTCTTTTTTTTTCTTGG + Intergenic
931921588 2:67022650-67022672 ATGTGGGTGACTTTATTTCTGGG - Intergenic
933223283 2:79715796-79715818 ATGTGGGTCACTCACTTTTCTGG - Intronic
933481303 2:82860225-82860247 ATGAGGGTAACTTTTTATTAAGG - Intergenic
933528522 2:83475611-83475633 ATGTGAGTGTTTTTTTTTTTAGG - Intergenic
934087945 2:88525791-88525813 TTGTGGGTTTTTTTTTTTTTTGG + Intronic
935310197 2:101775873-101775895 CTGTGGGTCAGTGTTTTTGTTGG + Intronic
935484069 2:103631084-103631106 AAGTCAGTCACATTTTTTTTTGG + Intergenic
936459114 2:112698535-112698557 ATGTGTTTCACTCTTTTTTATGG + Intergenic
936933108 2:117810428-117810450 ATGTGTATCCCTTTTTTTTTAGG + Intergenic
937176235 2:119938428-119938450 ATGTGGGTAAATTTTTTATGTGG + Intronic
937740354 2:125345271-125345293 ATTTGGGTTATTTTTGTTTTTGG - Intergenic
939358070 2:141130192-141130214 ATGTTTGTCAGTTTTTCTTTTGG - Intronic
939713902 2:145558758-145558780 ATTTGGGTCACTATCTGTTTAGG + Intergenic
939758404 2:146142718-146142740 ATGTGTGTGAATTTTTTTATTGG - Intergenic
940208278 2:151228848-151228870 ATGTGGGTCTCTTTCTTATTGGG - Intergenic
940431399 2:153593959-153593981 ATGTGGGTCAGATTATTTTACGG - Intergenic
940951421 2:159679470-159679492 ATGTGGGTTATTTTCTGTTTTGG + Intergenic
941218047 2:162738562-162738584 CTGTGGGTCTCTTGTTTTCTGGG - Intronic
941310549 2:163925309-163925331 ATGTAGGTGTCTTTGTTTTTTGG + Intergenic
941397611 2:164992567-164992589 ATATGGGTCTCTTTTTCTGTCGG - Intergenic
941487608 2:166101559-166101581 ATGTGTGTGACTTTATTTCTGGG - Intronic
941860786 2:170277707-170277729 ATTTGTGTAATTTTTTTTTTTGG - Intronic
942278334 2:174338544-174338566 TCGTGGGTCGATTTTTTTTTCGG + Intergenic
942402892 2:175622213-175622235 ATTTGAGTCACTATTGTTTTGGG + Intergenic
942438843 2:176010547-176010569 ATGTGTATCATTTATTTTTTAGG - Intergenic
944371600 2:198990268-198990290 TAGTGGGTCACTTATTTTTATGG - Intergenic
945266503 2:207896317-207896339 ATTTAGGTCACTTTTTATTCTGG - Intronic
945310727 2:208309135-208309157 GAGTTGTTCACTTTTTTTTTTGG + Intronic
945397503 2:209337867-209337889 ATTTTGCTCATTTTTTTTTTTGG + Intergenic
945759512 2:213896393-213896415 ATGTAGTTCTATTTTTTTTTAGG - Intronic
947075250 2:226336258-226336280 ATGTAGGTCGCTTTTTTATTTGG - Intergenic
1169115223 20:3059981-3060003 AATTGGGTCTTTTTTTTTTTTGG - Intergenic
1170178385 20:13498692-13498714 ATGTTGAACATTTTTTTTTTTGG - Intronic
1172111359 20:32547207-32547229 ATGTGTGTCACTTTCTTCTCTGG - Intronic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1172390117 20:34560150-34560172 GTGTGGTTCATCTTTTTTTTAGG + Exonic
1172968920 20:38859283-38859305 GTGCGGGTTCCTTTTTTTTTTGG + Intronic
1173374968 20:42474917-42474939 ATGTGGGTGACTGTTGTATTGGG - Intronic
1174361516 20:50031782-50031804 GTGTGTGTCACGTCTTTTTTTGG + Intergenic
1174559708 20:51421902-51421924 GTTTGGGTCAATTCTTTTTTGGG + Intronic
1174711432 20:52709738-52709760 GTGTGTGTAACTTTTATTTTAGG - Intergenic
1174955375 20:55091996-55092018 TTTTAGGTCACTTTTATTTTTGG - Intergenic
1175351839 20:58327697-58327719 ATGTAATTCACTCTTTTTTTTGG - Intronic
1175558269 20:59890940-59890962 TTTTGGGTCCCTTTTTTTCTTGG - Intronic
1175954434 20:62601630-62601652 ATGAGGGTCTCTTTGTTTTGGGG - Intergenic
1177071559 21:16515154-16515176 AGGTGTGCCACTTTATTTTTGGG + Intergenic
1177214340 21:18109030-18109052 ATTTGGGTCACCTTTTTGTAAGG + Intronic
1177487343 21:21776990-21777012 ATGTTGGTCTCCTTTCTTTTGGG + Intergenic
1177487692 21:21779998-21780020 ATGTGGGTCAATTTGTTTCTGGG + Intergenic
1178292344 21:31379604-31379626 ATTTGGGTTATTTTTCTTTTTGG - Intronic
1180218360 21:46341221-46341243 ATTTGGATCACTATTATTTTGGG + Intronic
1180566345 22:16669976-16669998 ATGTGTATCCCTTTTTTTTCTGG - Intergenic
1181470731 22:23137758-23137780 ATGTGGGGTTCTGTTTTTTTGGG + Intronic
1181688723 22:24546405-24546427 ATGTGGGTCACATTCTTTTCTGG - Intronic
1182061905 22:27404469-27404491 ATTTGGGTCACTCTTTTTTTTGG + Intergenic
1183125928 22:35782151-35782173 ATGGAGGTCACTTCATTTTTTGG + Intronic
1184402754 22:44283299-44283321 AGGTGGGACACTTTTCCTTTTGG - Intronic
1184985277 22:48128445-48128467 ATTTGGGTCACTTTTATGTTGGG - Intergenic
949288381 3:2433453-2433475 AGGTGGCTCATTTTTTTATTAGG + Intronic
951548654 3:23854536-23854558 ATGTGGGCCAGTTTATCTTTTGG + Intronic
952138659 3:30453920-30453942 ATTTGGGGCAATTTTTTTTCTGG - Intergenic
952628333 3:35434833-35434855 TTGTGGGTTTTTTTTTTTTTTGG + Intergenic
952857913 3:37787502-37787524 ATGTGTGTTAATTTTTTCTTAGG - Intronic
953823112 3:46225872-46225894 CTGAGGGTCATTTTGTTTTTTGG + Intronic
955000555 3:54923462-54923484 ATGTGGGTCTCATTTTTGATAGG - Intronic
955403847 3:58612919-58612941 ATGTGGGTCTCTTCCTTTCTAGG + Intronic
955792786 3:62605951-62605973 ATTTGGGTCTGATTTTTTTTTGG + Intronic
956403265 3:68902364-68902386 ATATCATTCACTTTTTTTTTTGG + Intronic
956644440 3:71442377-71442399 ATGTGGTTTTTTTTTTTTTTTGG - Intronic
958157891 3:89778109-89778131 AAGTGTGTGACTTTATTTTTAGG + Intergenic
958584303 3:96067617-96067639 ATCTGTGTCAATTTTATTTTGGG - Intergenic
958844210 3:99245766-99245788 AAATAGGTCACTTTTTTTTTTGG - Intergenic
958928278 3:100182312-100182334 ATGTGACTTACTTTTTCTTTTGG - Intergenic
959294647 3:104520721-104520743 ATGTGGATGACTTATTTTTCTGG - Intergenic
959410512 3:106015514-106015536 ATGTGGGTTATTTTCATTTTTGG - Intergenic
960206738 3:114911121-114911143 AACTAGGGCACTTTTTTTTTTGG - Intronic
960519461 3:118638352-118638374 AAGAGGGTCACTTTTATTCTGGG + Intergenic
960889018 3:122426664-122426686 ATGTGGCTCCCTTTTTCTTGTGG - Exonic
961844199 3:129747273-129747295 ATGTGTGTGAATTTTTTTTCGGG - Intronic
962649001 3:137469099-137469121 ATGTGGCTCACTTTTATGTCTGG - Intergenic
963591418 3:147264754-147264776 ATGTGGGTAAGTATTTTTGTTGG + Intergenic
963627999 3:147697339-147697361 TTTTGGTTCTCTTTTTTTTTTGG + Intergenic
963834652 3:150045720-150045742 GTTTGAGTCACTTTTTTTATAGG - Intronic
964329083 3:155581378-155581400 ATTTGGGTCATTTGCTTTTTGGG - Intronic
964913126 3:161806024-161806046 ATGTTGGATACTTTATTTTTAGG + Intergenic
965139970 3:164819755-164819777 ATTTGGGGCACTCTTTTTTGGGG - Intergenic
967080803 3:186047937-186047959 GTGTGGATGACTTTTATTTTAGG - Exonic
967581255 3:191157838-191157860 ATGTATTTCATTTTTTTTTTTGG - Intergenic
967713449 3:192736163-192736185 TTGGGGCTCACTTTTTTTTCTGG + Intronic
968197564 3:196721351-196721373 ATCTGGGTAAGTTTTTATTTCGG + Intronic
968683644 4:1940497-1940519 AGGTGTGACACTTTTTTGTTCGG + Intronic
968869066 4:3232185-3232207 TTGTGGGTCACTTCCTTCTTGGG - Intronic
970336379 4:15049200-15049222 TTTTGGGTCACTTTTCTCTTTGG + Intronic
971625811 4:28918547-28918569 ATGTTGGTCCCTATTTTTTGTGG - Intergenic
971989512 4:33873234-33873256 ATTTCGGTTACTTATTTTTTAGG + Intergenic
973122114 4:46534344-46534366 ATGTGGGTCCCTTTCTTTCTGGG - Intergenic
973894043 4:55395146-55395168 AAGTAGCTCACTTTTTCTTTTGG + Intergenic
974014179 4:56634055-56634077 GCGTGGGCCACTTTTTTTTTTGG - Intergenic
975031276 4:69620654-69620676 TTGTGGCTCTTTTTTTTTTTTGG - Intronic
976046439 4:80953947-80953969 ATATGGGTCCCTTTTACTTTTGG - Intronic
976063049 4:81153409-81153431 ATGTAGGTCACTTGATTTTTTGG - Intronic
978912583 4:114082143-114082165 ATTTCAGTCACTTCTTTTTTAGG + Intergenic
979062573 4:116082095-116082117 ATATTGTGCACTTTTTTTTTAGG + Intergenic
979282395 4:118882151-118882173 TTGTCGGTCACTTTTTATTGGGG + Intronic
981094891 4:140768874-140768896 ATATCTGTCACTGTTTTTTTTGG + Intergenic
981226781 4:142305740-142305762 CTGTTGGTCTCTTTTCTTTTAGG - Intronic
981671021 4:147287076-147287098 ATCTGGGTTACTTTTTCTTATGG - Intergenic
982124716 4:152174599-152174621 GTGTGTGTCACTTTTCTCTTTGG - Intergenic
982186219 4:152803394-152803416 ATTTGGGTAATTTTTTATTTTGG + Intronic
982698000 4:158625671-158625693 ATGTGAGTCAGTTTTATTTTAGG - Intronic
983003195 4:162446476-162446498 ATGTTGTTCACTCTATTTTTGGG + Intergenic
983163994 4:164452130-164452152 ATGTGGCTCACTCTCTATTTTGG - Intergenic
983484340 4:168316790-168316812 TTTTGGGTTTCTTTTTTTTTTGG - Intronic
983741133 4:171135848-171135870 ATGTGTATGACTTTTTATTTTGG + Intergenic
983889244 4:173014045-173014067 ATTTTTGCCACTTTTTTTTTTGG - Intronic
984455548 4:179962687-179962709 ATTTGGGTCAGTTTTATGTTTGG - Intergenic
984750196 4:183264995-183265017 AAGTGGATCACTCTTCTTTTTGG - Exonic
986420793 5:7579408-7579430 CTGTGGATCTCTTTTTTTTAGGG - Intronic
986426329 5:7635513-7635535 ATCTTGGTCACTTTATTTATTGG + Intronic
987086368 5:14472769-14472791 TCGTTGGTCACTTTTTATTTTGG - Intronic
987206714 5:15635021-15635043 ATGTGGACAATTTTTTTTTTTGG + Intronic
987578754 5:19761560-19761582 TTGTTGGGCAGTTTTTTTTTGGG - Intronic
987910912 5:24144173-24144195 TTGTGGGTCATTTTTCCTTTTGG - Intronic
988104088 5:26720768-26720790 ATCTTGGTCACTCTTTTATTTGG - Intergenic
988106368 5:26754193-26754215 ATGTGGCTGTATTTTTTTTTTGG + Intergenic
988165633 5:27585945-27585967 ATGTGTGTAACTTTATTTCTGGG + Intergenic
988195294 5:27997345-27997367 CTGTGCGTCACTTTATTTGTGGG - Intergenic
990796668 5:59550285-59550307 ATTTGGCTCATTTTTTTTCTTGG + Intronic
991171013 5:63625960-63625982 GTGTGGGTCACTTTGTCTCTGGG + Intergenic
991241360 5:64464630-64464652 ATTTGGGTTTTTTTTTTTTTTGG - Intergenic
991482539 5:67097198-67097220 ATGTAGCTCACCTTTTTTTATGG - Intronic
991615056 5:68487841-68487863 ATGTGTGTGAGTTTTTTTCTGGG + Intergenic
993571251 5:89541733-89541755 AGGTGATTTACTTTTTTTTTAGG + Intergenic
994270743 5:97773067-97773089 AATTGAGTTACTTTTTTTTTTGG + Intergenic
994520799 5:100832229-100832251 ATATGGGTTAGTTTTTCTTTTGG + Intronic
995195154 5:109358414-109358436 ATGTGGGTAAATCTTTGTTTGGG + Intronic
995240538 5:109881308-109881330 ATATGATCCACTTTTTTTTTTGG + Intergenic
995579565 5:113581732-113581754 AAATGGGTCACTTTTTATTCAGG + Intronic
996707167 5:126509095-126509117 ATGTGAGTCACATTTCTTTGAGG - Intergenic
997230135 5:132236363-132236385 TTGAGACTCACTTTTTTTTTTGG + Intronic
997490500 5:134271835-134271857 TTGTGGATCACATTTTTTCTGGG + Intergenic
997645434 5:135478413-135478435 ATGTGGGTTTTTTTGTTTTTTGG + Intergenic
998473918 5:142405060-142405082 ATATAGGTCAATTTTTTGTTCGG + Intergenic
998559669 5:143159570-143159592 ATGTTGGTAATTTTTATTTTAGG - Intronic
1000078633 5:157821260-157821282 TTGTGGGTCAAGTTTTCTTTTGG - Intronic
1000886448 5:166753269-166753291 ATGAACGTCCCTTTTTTTTTCGG + Intergenic
1001438611 5:171720409-171720431 ATGTGGGTCACTTCTATTGTAGG - Intergenic
1004779454 6:18892212-18892234 ATGTAGATCACTTTCTATTTTGG + Intergenic
1005160885 6:22862166-22862188 ATGTGGGTCTCTTTTTCTAAAGG - Intergenic
1007518588 6:42433300-42433322 TTGGGGTTCACTTTTTTTTCTGG - Intronic
1007906166 6:45463152-45463174 TCCTGGGTCACTTTTCTTTTTGG + Intronic
1007985998 6:46207181-46207203 ATGTGGGTCACTTTTTTTTTTGG - Intergenic
1008129045 6:47699948-47699970 ATGTGGGTCACTTAACTCTTAGG + Intronic
1008307331 6:49919035-49919057 ATGGAGGTCACTTCTTTTATAGG + Intergenic
1008369005 6:50712606-50712628 ATGTGGCTTTTTTTTTTTTTAGG - Intergenic
1009324237 6:62330165-62330187 ATGTGGATAACTTTTTAATTAGG + Intergenic
1009740505 6:67737462-67737484 AGGTGTGTCACTTTATTTCTGGG + Intergenic
1009954998 6:70442735-70442757 ATGTCTGGCTCTTTTTTTTTGGG - Intronic
1009963186 6:70549509-70549531 ATGTGACTCACCTTTTTTTATGG - Intronic
1010363912 6:75027721-75027743 ATGTGGGTCTTTTTTTATTCTGG + Intergenic
1010697080 6:78989430-78989452 ATGTGATTCTCTTTTTTGTTTGG - Intronic
1010700219 6:79035799-79035821 ATTTGGTTCAATTTTTTTCTAGG + Intronic
1010715917 6:79229877-79229899 ATGTTTATCATTTTTTTTTTTGG - Intronic
1010719310 6:79264204-79264226 ATGTTAGTCACTATTCTTTTTGG - Intergenic
1011403442 6:86989901-86989923 TTGTAGGTATCTTTTTTTTTTGG - Intronic
1011707936 6:90022208-90022230 ATTTGGGTTATTTTTTATTTTGG - Intronic
1011964057 6:93130541-93130563 ATGTGAGTTACTTTCTCTTTTGG + Intergenic
1012800809 6:103825251-103825273 ATGTGGGTTTTTTTTTTGTTGGG - Intergenic
1014164797 6:118211522-118211544 ATGTCAGTCACTTGTTTCTTTGG - Intronic
1014171901 6:118288005-118288027 ATTTGGGTTTTTTTTTTTTTTGG + Intronic
1015642677 6:135352805-135352827 TTGTGGGTTTTTTTTTTTTTTGG + Intronic
1016022037 6:139246075-139246097 ATGTGCATCATTTTTTTTTATGG + Intronic
1016304268 6:142666986-142667008 ATGTGTGTCCCTTCTATTTTTGG - Intergenic
1016329406 6:142941108-142941130 ATTTGGGTCACTATTGTTCTAGG - Intronic
1017494669 6:154973172-154973194 TTGTGGGTTTGTTTTTTTTTTGG + Intronic
1017993750 6:159512415-159512437 ATGTGGGTCACTTCTTTCAGGGG - Intergenic
1020585276 7:10058047-10058069 TTGTGGCTCAATTTTTGTTTGGG + Intergenic
1020611063 7:10398627-10398649 AAATAGGTCACTTTATTTTTGGG + Intergenic
1021154752 7:17196089-17196111 ATTTGGTTAATTTTTTTTTTTGG - Intergenic
1021321793 7:19221588-19221610 ATGTGGGTCACTGATTATATAGG - Intergenic
1021449214 7:20766469-20766491 ATGTGTAACACTTTTTTTTTAGG - Intronic
1023231360 7:38033599-38033621 ATCTGGGATCCTTTTTTTTTAGG + Intergenic
1023575876 7:41625860-41625882 ATCTTGGTTCCTTTTTTTTTAGG - Intergenic
1025166912 7:56720553-56720575 ATGTTTGTCTCTTTTTTATTTGG - Intergenic
1025959429 7:66206676-66206698 GTTTGGGTAACTTTCTTTTTAGG + Intronic
1025960302 7:66214801-66214823 TTGTTGGTGGCTTTTTTTTTAGG - Intronic
1026442158 7:70454185-70454207 ATGGGGGTCTCTCTTTTTTTGGG + Intronic
1027712470 7:81622792-81622814 ATTTTGCTCACTTTTTTTCTTGG - Intergenic
1027781453 7:82525579-82525601 AAGTTGCTCTCTTTTTTTTTTGG - Intergenic
1027809199 7:82871740-82871762 TTCTGGGTCATTTTTTTTATTGG - Intronic
1029017048 7:97325774-97325796 ATGTGGGGGACTTTTTTTCCAGG + Intergenic
1029050826 7:97685097-97685119 AGCTAGGTCACTTTTTTTTTAGG - Intergenic
1029994365 7:104992441-104992463 AATTTGGTCACTTTTTTTTTTGG + Intergenic
1029999029 7:105038024-105038046 GTGTGAGTCACTTTGGTTTTAGG + Intronic
1030137405 7:106268627-106268649 ATGTGGGTTTCTTTCTGTTTTGG - Intronic
1030577281 7:111304763-111304785 ATGTGGGTCATCTTGATTTTGGG - Intronic
1030640447 7:111999778-111999800 ATATATGTCATTTTTTTTTTTGG - Intronic
1032903993 7:136343244-136343266 AGGTGGCTCACTCTATTTTTGGG + Intergenic
1033011025 7:137623009-137623031 ATGTGCATGACTTTTTATTTTGG - Intronic
1034134730 7:148756323-148756345 ATGTTGATTTCTTTTTTTTTTGG + Intronic
1035290639 7:157836390-157836412 ATGTGGCTTACTGTTTCTTTAGG - Intronic
1035810698 8:2488753-2488775 CTGTGGGTCAATATGTTTTTTGG - Intergenic
1036241344 8:7083757-7083779 ATGTGGATTATTTGTTTTTTAGG + Intergenic
1038026822 8:23598284-23598306 ATGTGTGTTTTTTTTTTTTTTGG - Intergenic
1038307656 8:26419376-26419398 ATGTGGTTTTCTTTTTTATTAGG + Intronic
1038823042 8:30970503-30970525 ACGTTGGTTAATTTTTTTTTCGG + Intergenic
1038965249 8:32564908-32564930 AACTGGCTAACTTTTTTTTTTGG - Intronic
1039273472 8:35908603-35908625 TTCTTGGTCACTTTTGTTTTTGG + Intergenic
1039282284 8:35998503-35998525 AGGTGGGTTTTTTTTTTTTTCGG + Intergenic
1039400514 8:37265330-37265352 ATGTGGGCCACTGACTTTTTTGG - Intergenic
1039729948 8:40263478-40263500 TAGTGGGACACATTTTTTTTTGG + Intergenic
1040220662 8:45150532-45150554 ATGTGAAACACTCTTTTTTTTGG + Intergenic
1041159643 8:55026394-55026416 ATTTGGGCCACTTTGCTTTTTGG - Intergenic
1041806727 8:61859099-61859121 ATCTGGGTCATTTCTATTTTTGG - Intergenic
1042112773 8:65398500-65398522 ATGTGGTTATCATTTTTTTTAGG - Intergenic
1042319212 8:67457415-67457437 ATATGGGGGACTTATTTTTTTGG + Intronic
1042585218 8:70329643-70329665 ATTTGGGTCACTTTCTATTTTGG - Intronic
1042632065 8:70829040-70829062 ATATGGGCCACTTATTTTGTTGG - Intergenic
1043965926 8:86475568-86475590 ATGTTCTCCACTTTTTTTTTTGG - Intronic
1045387660 8:101687071-101687093 ATGTGGCTCACTTTTCTTTCTGG + Exonic
1046275888 8:111959159-111959181 ATTTGGAACACTTGTTTTTTAGG + Intergenic
1047930484 8:129723700-129723722 CTCTGGGTCTCTTTTTATTTTGG - Intergenic
1049652007 8:143774176-143774198 ATGTGGTTTTTTTTTTTTTTTGG - Intergenic
1050713803 9:8497080-8497102 GTGTGGTGCACTTTTTATTTTGG - Intronic
1050786572 9:9411095-9411117 TTGTGGTTCACTTCTTTTTCAGG - Intronic
1050962109 9:11747521-11747543 ATGTGGCTCAATTCTTTCTTTGG - Intergenic
1051625503 9:19096163-19096185 ATCTGGGTGATTTTTTTCTTTGG - Intronic
1052188961 9:25634077-25634099 ATGTGTGTCACATTTTCTTGTGG + Intergenic
1052629072 9:31013811-31013833 ATATGGGTGACTGTTTCTTTTGG - Intergenic
1052811737 9:33066846-33066868 TTTTGGGTCTCTTATTTTTTTGG - Intronic
1053046268 9:34921384-34921406 ATGTATTTAACTTTTTTTTTAGG - Intergenic
1053400665 9:37817737-37817759 TTCTGGGAGACTTTTTTTTTTGG - Intronic
1053597370 9:39575988-39576010 GTGTGGGTTTTTTTTTTTTTGGG - Intergenic
1054568894 9:66789011-66789033 GTGTGGGTTTTTTTTTTTTTGGG + Intergenic
1054899032 9:70348196-70348218 ATTAGGGTCACTTTTTTTGGGGG + Intronic
1055202833 9:73687822-73687844 TTTTGTGTCACTTTTGTTTTAGG - Intergenic
1056255297 9:84793294-84793316 AACTGGGGCAATTTTTTTTTTGG - Intronic
1056855467 9:90124904-90124926 GTTTGGGTCACTTTTTTCTATGG - Intergenic
1057887583 9:98842084-98842106 TTGTGGCTCATTGTTTTTTTTGG + Intronic
1058106905 9:100982772-100982794 ATCTGGGCCATTTTTATTTTAGG + Intergenic
1059842990 9:118239340-118239362 ATTTGGGTTTTTTTTTTTTTTGG + Intergenic
1187043564 X:15623033-15623055 ATGCAGATAACTTTTTTTTTTGG - Intergenic
1187189350 X:17018619-17018641 ATGTGGCTCACATTCTTTTTTGG + Intronic
1188470990 X:30538951-30538973 GTGTGGGTTTTTTTTTTTTTTGG - Intergenic
1188529406 X:31122663-31122685 ATGTGGGTCACCTTATAATTAGG - Intronic
1188819925 X:34762670-34762692 ATGTGGATAACTTTTTTTTCAGG - Intergenic
1188824075 X:34808635-34808657 ATTTGGGTAACTTATTTTCTAGG - Intergenic
1188892272 X:35625729-35625751 CTGTGTATTACTTTTTTTTTGGG - Intergenic
1189790019 X:44594999-44595021 ATGTATCTCATTTTTTTTTTTGG + Intergenic
1189823808 X:44896949-44896971 GTGTGGGTGTCTTTTTTATTTGG + Intronic
1189862605 X:45289109-45289131 ATGTGAGACACTGTTTTTTGTGG - Intergenic
1192013155 X:67297332-67297354 AAGTGTCTCACTTTTTTTTAAGG - Intergenic
1192590021 X:72351859-72351881 ATGTGGCTTAATTTGTTTTTTGG - Intronic
1193289569 X:79755617-79755639 ATGTGGGCCACGGTTTTTTGTGG + Intergenic
1193943113 X:87701047-87701069 CTGTGGGCCACTTTTTTCCTCGG + Intergenic
1196360966 X:114857500-114857522 ATGTTGGGCACTTTTTGTTATGG + Intronic
1196924784 X:120622740-120622762 ATTTGGGGCAATATTTTTTTGGG + Intergenic
1198104398 X:133448596-133448618 ATGTGGGCCACTCTTTTCTGTGG - Intergenic
1200923495 Y:8633811-8633833 ATGTGGGACTCCATTTTTTTTGG + Intergenic
1201238920 Y:11939045-11939067 ATGAGTTTCACTTTTTATTTTGG - Intergenic
1202135948 Y:21661748-21661770 ATTATGATCACTTTTTTTTTAGG + Intergenic
1202270327 Y:23065988-23066010 AGAGGGGGCACTTTTTTTTTTGG + Intergenic
1202295700 Y:23354694-23354716 AGAGGGGGCACTTTTTTTTTTGG - Intergenic
1202423321 Y:24699733-24699755 AGAGGGGGCACTTTTTTTTTTGG + Intergenic
1202447468 Y:24970353-24970375 AGAGGGGGCACTTTTTTTTTTGG - Intergenic