ID: 1007986939

View in Genome Browser
Species Human (GRCh38)
Location 6:46216576-46216598
Sequence GCTTCTCTCAACCATCCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007986939_1007986940 -4 Left 1007986939 6:46216576-46216598 CCACAGGGATGGTTGAGAGAAGC No data
Right 1007986940 6:46216595-46216617 AAGCCCTCCTTTCTCCACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007986939 Original CRISPR GCTTCTCTCAACCATCCCTG TGG (reversed) Intergenic
No off target data available for this crispr