ID: 1007987937

View in Genome Browser
Species Human (GRCh38)
Location 6:46225956-46225978
Sequence TTGTGTATAAAGTAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1878
Summary {0: 1, 1: 0, 2: 3, 3: 79, 4: 1795}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007987934_1007987937 -8 Left 1007987934 6:46225941-46225963 CCATCTTGAATTAATTTGTGTAT 0: 40
1: 7537
2: 10923
3: 7453
4: 7036
Right 1007987937 6:46225956-46225978 TTGTGTATAAAGTAGGAGGAAGG 0: 1
1: 0
2: 3
3: 79
4: 1795

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007987937 Original CRISPR TTGTGTATAAAGTAGGAGGA AGG Intronic
900916350 1:5641624-5641646 TTTTGTATAAGGTATAAGGAAGG - Intergenic
902102355 1:14001821-14001843 TTTTGTATAAGGTATAAGGAAGG - Intergenic
903548307 1:24140953-24140975 TTGTGTGTAGAGTTGGAGTAGGG - Intronic
903566466 1:24269936-24269958 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
904436193 1:30498365-30498387 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
904816703 1:33208104-33208126 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
905157561 1:35998943-35998965 TTATGTATATAGTATGAGGTAGG + Intronic
906485872 1:46234576-46234598 TTAAATATAAAGTAGAAGGAAGG - Intergenic
906587216 1:46989869-46989891 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
906600490 1:47124119-47124141 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
906682726 1:47741069-47741091 TTTTGTATAAGGTATAAGGAAGG - Intergenic
906752160 1:48274511-48274533 TTTTGTATAAGGTATAAGGAAGG + Intergenic
906886848 1:49657828-49657850 TTTTGTATAAGGTATAAGGAAGG - Intronic
906970895 1:50512410-50512432 TTTTGTATAAGGTGGAAGGAAGG + Intronic
907370189 1:53996958-53996980 TTTTGTATAAGGTATAAGGAAGG - Intergenic
907473446 1:54689615-54689637 TTGGGTTTGAAGGAGGAGGAGGG + Intronic
907532449 1:55114714-55114736 TTTTGTATAAAGTGTAAGGAAGG - Intronic
907979368 1:59466325-59466347 TTTTGTATAAGGTATAAGGAAGG - Intronic
908037115 1:60067893-60067915 TTTTGTATAAGGTATAAGGAAGG + Intronic
908075571 1:60514116-60514138 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
908092950 1:60705965-60705987 TTGTGTATAATGTAAGATAAGGG + Intergenic
908279757 1:62520071-62520093 TTTTGTATAAGGTATAAGGAAGG - Intronic
908316392 1:62937024-62937046 TTGTGTTGACAGTAGGAGGAAGG + Intergenic
908435891 1:64105626-64105648 TTTTGTATAAGGTATAAGGAAGG + Intronic
908617629 1:65940174-65940196 TTGTATAAAAAGTAGGGGGCAGG + Intronic
908778524 1:67666346-67666368 TTTTGTATAAAGTGTAAGGAGGG + Intergenic
908896187 1:68902827-68902849 TTTTATATAAAATAGGAAGATGG + Intergenic
908943411 1:69464482-69464504 TTTTTTATAAAGTATAAGGAAGG + Intergenic
909053596 1:70796863-70796885 TTTTGTATAAGGTATAAGGATGG + Intergenic
909221198 1:72963928-72963950 TTTTGTATAAGGTATAAGGAAGG - Intergenic
909259631 1:73470668-73470690 TTTTGTATAAGGTATAAGGAAGG - Intergenic
909309908 1:74132684-74132706 TTTTGTATAAGGTATAAGGAAGG - Intronic
909370089 1:74873471-74873493 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
909434188 1:75621004-75621026 TTTTGTATAAGGTAGAAGGAAGG + Intergenic
909473054 1:76051092-76051114 TTTTGTATAAGGTATAAGGAAGG + Intergenic
909499022 1:76312249-76312271 TTTTGTATAAGGTATAAGGAAGG - Intronic
909558800 1:76985977-76985999 TTTTGTATAAGGTATAAGGAAGG - Intronic
910282177 1:85513321-85513343 TTTTGTATAAGGTATAAGGAAGG - Intronic
910398941 1:86819291-86819313 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
910764405 1:90766655-90766677 TTTTGTATAAGGTATGAGAAAGG + Intergenic
910941082 1:92534743-92534765 TTTTGTATAAAGTGTAAGGAAGG - Intronic
910954517 1:92687360-92687382 TTTTGTATAAGGTGTGAGGAAGG - Intronic
911128564 1:94365441-94365463 TTTTGTATAAAGTGTAAGGAGGG + Intergenic
911202840 1:95063463-95063485 TTCTGTATAAAGTGTAAGGAAGG + Intronic
911462906 1:98213222-98213244 TTTTGTATAAGGTAGAAGGAAGG + Intergenic
911535257 1:99092096-99092118 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
911815351 1:102343074-102343096 TTTTGTATAAGGTATAAGGAAGG - Intergenic
911885030 1:103287438-103287460 TTTTGTATAAGGTATAAGGAAGG + Intergenic
911904124 1:103544856-103544878 TTGAATATAAAATAGGAGGTGGG + Intronic
911923462 1:103796307-103796329 TTTTGTATAAGGTATAAGGAAGG + Intergenic
911963873 1:104340946-104340968 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
912082085 1:105949280-105949302 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
912097924 1:106168218-106168240 TTTTGTATAAGGTATAAGGAAGG - Intergenic
912132927 1:106623954-106623976 TTTTGTATAAGGTATAAGGAAGG + Intergenic
912235838 1:107849549-107849571 TTTTGTATAAGGTATAAGGAAGG - Intronic
912261434 1:108114687-108114709 TTTTGTATAAAGTAGGAGGTGGG - Intergenic
912374693 1:109200716-109200738 TAGTCTATAAAACAGGAGGATGG - Exonic
912889479 1:113513597-113513619 TTTTGTATAAGGTGTGAGGAAGG - Intronic
913033572 1:114937365-114937387 TTTTGTATAAGGTATAAGGAAGG - Intronic
913040237 1:115015221-115015243 TTTTGTATAAGGTATAAGGAAGG + Intergenic
913335476 1:117705835-117705857 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
913525862 1:119692264-119692286 TTTTGTATAAGGTATAAGGAAGG + Intronic
914979593 1:152401370-152401392 TTTTGTATAAGGTATAAGGAAGG + Intergenic
915003633 1:152616399-152616421 TTTTGTATAAGGTATAAGGAAGG - Intergenic
915618806 1:157065526-157065548 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
915743313 1:158136772-158136794 TTTTGTATAAGGTATAAGGAAGG + Intergenic
915843354 1:159235899-159235921 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
915875574 1:159608711-159608733 TTTTGTATAAGGTATAAGGAAGG - Intergenic
916172879 1:162014383-162014405 TTGGGTATATAGGAGGAGGTAGG - Intronic
916283575 1:163079804-163079826 TTTTGTATAAGGTATAAGGAAGG - Intergenic
916621467 1:166502613-166502635 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
916768675 1:167886518-167886540 TTTTGTATAAGGTGGAAGGAAGG - Intronic
916836339 1:168549512-168549534 TTTTGTATAAGGTGGAAGGAAGG - Intergenic
917358181 1:174148217-174148239 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
917413217 1:174781737-174781759 TTTTGTATAAGGTATAAGGAAGG + Intronic
917424201 1:174896610-174896632 TTTTGTATAAGGTATAAGGAAGG + Intronic
917555786 1:176087079-176087101 TTTTGTATAAGGTATAAGGAAGG - Intronic
917579501 1:176360815-176360837 TTTTGTATAAGGTATAAGGAAGG - Intergenic
917984781 1:180305069-180305091 TTTTGTATAAAGTGTAAGGAAGG - Intronic
918031342 1:180815378-180815400 TTGTGTATGTTGTAGGGGGAGGG + Intronic
918159647 1:181886280-181886302 TTTTGTATAAGGTATAAGGAAGG + Intergenic
918269127 1:182879202-182879224 CTGTGTATACACAAGGAGGATGG + Intronic
918342634 1:183580178-183580200 TTGGGTTTGAAATAGGAGGATGG + Intronic
918483677 1:185006360-185006382 TTTTGTATAAGGTATAAGGAAGG - Intergenic
918542028 1:185642878-185642900 TTTTGTATAAGGTATAAGGAAGG - Intergenic
918592687 1:186257763-186257785 TTTTGTATAAGGTATAAGGAAGG + Intergenic
918643682 1:186876530-186876552 TTGCCTATAAATTAGGAGTAGGG + Intronic
918679371 1:187332863-187332885 TTTTGTATAAGGTATAAGGAAGG + Intergenic
918694885 1:187533254-187533276 TTTTGTATAAAATATAAGGAAGG - Intergenic
918826056 1:189326451-189326473 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
918967783 1:191373963-191373985 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
918998887 1:191801547-191801569 TTTTGTATAAGGTATAAGGAAGG + Intergenic
919284111 1:195531434-195531456 TTTTGTATAAGGTAAGAGGTAGG - Intergenic
919293906 1:195669595-195669617 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
919353065 1:196484696-196484718 TTTTGTATAAGGTATAAGGAAGG + Intronic
919602992 1:199646151-199646173 TTATTTATTAAGTAGGAGAAAGG + Intergenic
920590332 1:207211714-207211736 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
920637903 1:207722363-207722385 TTTTGTATAAGGTGTGAGGAAGG + Intronic
920639220 1:207735301-207735323 TTTTGTATAAGGTGTGAGGAAGG - Intronic
920642932 1:207771567-207771589 TTTTGTATAAGGTGTGAGGAAGG + Intronic
920986042 1:210890364-210890386 TTTTGTATAAAGTGTAAGGAAGG - Intronic
921185024 1:212663000-212663022 TTTTGTATAAGGTATAAGGAAGG - Intergenic
921275507 1:213515400-213515422 TTTTGTATAAGGTATAAGGAAGG + Intergenic
921288011 1:213626597-213626619 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
921476205 1:215613670-215613692 TTTTGTATGTAGTAAGAGGAAGG + Intronic
921615123 1:217257588-217257610 TTTTGTATAAAGTGCAAGGAAGG - Intergenic
921734976 1:218616960-218616982 TTGTGCATAAAGGAGGGGGTGGG + Intergenic
922138624 1:222858299-222858321 TTTTGTATAAGGTATAAGGAAGG - Intergenic
922206492 1:223451830-223451852 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
923314699 1:232768521-232768543 TTGTCCATCAAGCAGGAGGATGG - Intergenic
924255253 1:242176406-242176428 TTTTGTATAAACTATAAGGAAGG - Intronic
924307498 1:242705763-242705785 TTTTGTATAAGGTATAAGGAAGG - Intergenic
924332252 1:242951867-242951889 TTTTGTATATAGTATAAGGAAGG - Intergenic
924392424 1:243577516-243577538 TTTTGTATAAGGTATAAGGAAGG - Intronic
924401311 1:243685348-243685370 TTGTGCATAAAGTGTAAGGAAGG + Intronic
924613702 1:245594339-245594361 TTTTGTATAAGGTATAAGGAAGG + Intronic
924663509 1:246045452-246045474 TTTTGTATAAAGTGTAAGGAAGG - Intronic
924891920 1:248291903-248291925 TTTTGTATAAAGTTGAAGGAAGG - Intergenic
924901327 1:248404206-248404228 GTGTGTATAAAATGGGAGTAAGG + Intergenic
924952900 1:248901561-248901583 TTTTGTATAAAGTGTAAGGATGG - Intergenic
1062912672 10:1222586-1222608 TTTTGTATAAAGTGTAAGGAAGG + Intronic
1063850382 10:10182711-10182733 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1064150566 10:12860565-12860587 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
1064259549 10:13774238-13774260 TATTGTATAAAGTAGGGGGGTGG + Intronic
1064295129 10:14072408-14072430 ATGTTTATAAAGTAGAAGGACGG - Intronic
1064473890 10:15665687-15665709 TTTTGTATAAGGTATAAGGAAGG + Intronic
1064577544 10:16761481-16761503 TTGAGTATAAAGTGTGAGGCGGG - Intronic
1064671357 10:17717979-17718001 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1064734934 10:18372374-18372396 TTTTGTATAAGGTATAAGGAAGG + Intronic
1064771283 10:18726228-18726250 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1064817705 10:19285423-19285445 TTTTGTATAAGGTATAAGGAAGG + Intronic
1064859355 10:19810387-19810409 TTTTGTATAAAATGTGAGGAAGG - Intergenic
1065157378 10:22884418-22884440 TTTTGTATAAAGTGAAAGGAAGG - Intergenic
1065503484 10:26405049-26405071 TTTTGTATATAGTATGAGAAAGG + Intergenic
1066033541 10:31455233-31455255 TTTTGTATAAAGTGTAAGGAAGG - Intronic
1066627826 10:37427345-37427367 TTCTTTAGAAAATAGGAGGAGGG + Intergenic
1066713729 10:38264139-38264161 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1066786605 10:39011244-39011266 TTTTGTATAAGGTGGAAGGAAGG + Intergenic
1067012514 10:42727695-42727717 TTGAGTATAAAGTGTGAGGCAGG + Intergenic
1067193799 10:44095875-44095897 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1067194817 10:44107903-44107925 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1067311079 10:45114193-45114215 TTGAGTATAAAGTGTGAGGCAGG - Intergenic
1067328957 10:45296413-45296435 TTTTGTATAAGGTACAAGGAAGG + Intergenic
1067331663 10:45327803-45327825 TTTTGTATACAGTGGAAGGAAGG + Intergenic
1067413119 10:46082386-46082408 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1067755826 10:49003866-49003888 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1068001297 10:51337231-51337253 TTTTGTATAAGGTATAAGGAAGG - Intronic
1068057032 10:52024083-52024105 TTTTGTATAAGGTGTGAGGAAGG + Intronic
1068057159 10:52025497-52025519 TTTTGTATAAGGTATAAGGAAGG + Intronic
1068071441 10:52201224-52201246 TTTTGTATATAGTATAAGGAAGG + Intronic
1068111472 10:52685541-52685563 TTTTGTATAAGGTAAAAGGAAGG + Intergenic
1068114170 10:52718674-52718696 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1068185308 10:53577546-53577568 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1068289796 10:54988033-54988055 TTTTGTATAAGGTATAAGGAAGG + Intronic
1068943349 10:62703462-62703484 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1069122362 10:64582930-64582952 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1069255862 10:66331237-66331259 TTGTGTATAAGGTGTAAGGAAGG + Intronic
1070007616 10:72440369-72440391 TTTTGTATAAGGTATAAGGAAGG - Intronic
1070007939 10:72443541-72443563 TTTTGTATAAGGTATAAGGAAGG + Intronic
1070077337 10:73150344-73150366 TTTTGTATAAGGTATAAGGAAGG - Intronic
1070186762 10:74071151-74071173 TTCTGCAAAAAGTAGGAAGAGGG - Intronic
1070544642 10:77442777-77442799 TTGGGTGTGAAGGAGGAGGAGGG - Intronic
1070619553 10:77998123-77998145 TTTTGTATAAGGTATAAGGAAGG - Intronic
1070714281 10:78707927-78707949 GTGTGCATACAGAAGGAGGAAGG - Intergenic
1070958244 10:80479463-80479485 TTTTGTATAAAGTGCAAGGAAGG + Intronic
1070980017 10:80636959-80636981 TTTTGTATAAGGTATAAGGAAGG + Intronic
1070990048 10:80723681-80723703 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1071006154 10:80886417-80886439 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1071188071 10:83066708-83066730 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1071323307 10:84486914-84486936 TTTTGTATAAGGTATAAGGAAGG + Intronic
1071373403 10:84976914-84976936 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1071663170 10:87526716-87526738 TTTTGTATAAGGTGTGAGGAAGG + Intronic
1071708431 10:88025005-88025027 CTGTGTGTAAAGCAGGATGAAGG + Intergenic
1071765693 10:88662491-88662513 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1071839022 10:89449578-89449600 TTTTGTATAAGGTATAAGGAAGG - Intronic
1071913668 10:90265708-90265730 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1071919588 10:90334396-90334418 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1071933396 10:90499157-90499179 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1072356912 10:94620633-94620655 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1072358493 10:94635516-94635538 TTATGTATAAGGTATAAGGAAGG + Intergenic
1072410690 10:95199321-95199343 TTTTGTATAAGGTATAAGGAAGG - Intronic
1072874525 10:99157572-99157594 TTTTGTATAAGGTATAAGGAAGG - Intronic
1072876636 10:99180081-99180103 TTTTGTATAAGGTATAAGGAAGG - Intronic
1073235529 10:102012132-102012154 TTCTTTTTAAAGGAGGAGGAAGG + Intronic
1073467412 10:103702238-103702260 TTGTGTATGAAGTAAGAGAGTGG + Intronic
1073645421 10:105296738-105296760 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1073838049 10:107466827-107466849 TTTTGTATAAAGTGTAAGGACGG - Intergenic
1073913324 10:108372510-108372532 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1073943474 10:108724609-108724631 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1073949840 10:108794810-108794832 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1074241307 10:111642049-111642071 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1074271246 10:111955954-111955976 CTCTGTAGAGAGTAGGAGGAAGG - Intergenic
1074351827 10:112745174-112745196 TTGTGGAGAGAGTAGGAAGAGGG + Intronic
1075036957 10:119077516-119077538 TTGTATATAAATTAGGACAAAGG - Intronic
1075174926 10:120150746-120150768 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1075496056 10:122920052-122920074 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1076461640 10:130651374-130651396 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1077654384 11:4004556-4004578 TTTTGTATAAGGTATAAGGAAGG - Intronic
1077701616 11:4447310-4447332 TTGGATATAAAGGATGAGGAAGG + Intergenic
1077762026 11:5112055-5112077 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1077930922 11:6731942-6731964 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1077933767 11:6761130-6761152 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1077944279 11:6878009-6878031 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1078120108 11:8498902-8498924 TTTTGTATAAGGTATAAGGAAGG - Intronic
1078560845 11:12370912-12370934 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1078998820 11:16732557-16732579 TTTTGTATAAAGTGTAAGGAAGG - Intronic
1079178142 11:18162751-18162773 TTTTGTATAAGGTGTGAGGAAGG - Intronic
1079263031 11:18902088-18902110 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1079276696 11:19044962-19044984 TTTTGTGTAAGGTGGGAGGAAGG - Intergenic
1079534173 11:21491368-21491390 TTTTGTATAAGGTATAAGGAAGG + Intronic
1079548128 11:21660204-21660226 TTGTCTATGAACTAGGAAGAAGG - Intergenic
1079673303 11:23194717-23194739 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1079696553 11:23489000-23489022 CTGTGTATAAGGTATAAGGAAGG - Intergenic
1079708134 11:23647441-23647463 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1079813460 11:25025116-25025138 TTTTGTATAAGGTATAAGGAAGG - Intronic
1079845525 11:25461997-25462019 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1079957967 11:26887465-26887487 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1080095157 11:28397061-28397083 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1080164447 11:29220158-29220180 TTTTATATAAAGTGTGAGGAAGG + Intergenic
1080488468 11:32735980-32736002 TTTTGTATAAAGTGTAAGGAAGG - Intronic
1080491307 11:32767291-32767313 TTTTGTATAAAGTGTAAGGAAGG - Intronic
1080535392 11:33216664-33216686 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1080558772 11:33442091-33442113 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1081317306 11:41646239-41646261 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1081748311 11:45488472-45488494 TCATCTATAAAGTAGGAGGCCGG + Intergenic
1081798285 11:45837987-45838009 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1082151019 11:48738844-48738866 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1082220231 11:49626043-49626065 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1082269435 11:50153811-50153833 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1082305023 11:50561660-50561682 TTTTGTATAAGGTAGAAGGAAGG - Intergenic
1082622527 11:55441411-55441433 TTTTGTATAAAGCATAAGGAAGG + Intergenic
1082643968 11:55699489-55699511 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1082871687 11:57948718-57948740 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1082957180 11:58882752-58882774 TTTTGTATAAAGTGTAAGGAAGG + Intronic
1083494345 11:63037487-63037509 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1083496569 11:63059602-63059624 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1083518796 11:63287167-63287189 TTTTGTATAAAGTGTAAGGAAGG - Intronic
1083525806 11:63363614-63363636 TTTTGTATAAGGTGTGAGGAAGG - Intronic
1084989117 11:72906596-72906618 TTTTGTATAAAGTGTAAGGAAGG + Intronic
1085609204 11:77931910-77931932 TTTTGTATAAAGTGTAAGGAAGG - Intronic
1085644155 11:78212110-78212132 TTTTGTATAAGGTATAAGGAGGG + Intronic
1085850781 11:80117152-80117174 TTGAGCACAAAGGAGGAGGAGGG - Intergenic
1085969020 11:81564673-81564695 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1086271213 11:85069122-85069144 TTTTGTATAAAGTGTAAGGAGGG - Intronic
1086277548 11:85148919-85148941 TTTTGTATAAAGTATAAGGAAGG + Intronic
1086311823 11:85544161-85544183 TTTTGTATAAGGTATAAGGAAGG + Intronic
1086422389 11:86650278-86650300 TTTTGTATAAGGTATAAGGAAGG - Intronic
1086501486 11:87458223-87458245 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1086519521 11:87653730-87653752 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1086544068 11:87947559-87947581 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1086638216 11:89117830-89117852 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1086789405 11:91016841-91016863 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1086793710 11:91073373-91073395 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1086868622 11:92010683-92010705 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1086883299 11:92174384-92174406 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1086907143 11:92431682-92431704 TTTTGTATAAGGTATAAGGAAGG + Intronic
1086991516 11:93308808-93308830 TTTTGTATACAGTATAAGGAAGG - Intergenic
1087000762 11:93418001-93418023 TTTTGTATAAGGTATAAGGAAGG - Intronic
1087102082 11:94375326-94375348 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1087383558 11:97440036-97440058 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1087435968 11:98117988-98118010 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1087613822 11:100465993-100466015 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1087794723 11:102443516-102443538 TTTTGTATAATGTATAAGGAAGG - Intronic
1087910094 11:103742500-103742522 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1087911704 11:103761398-103761420 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1087972335 11:104499952-104499974 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1087981188 11:104616606-104616628 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1088021016 11:105119613-105119635 TTTTGTATAAGGCAGGAGGTAGG - Intergenic
1088128317 11:106456368-106456390 TAGTTTATAAATTAAGAGGAAGG + Intergenic
1088229710 11:107661264-107661286 TTGTGTGTAAGGTAGGAAAATGG + Intronic
1088370716 11:109085562-109085584 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1088424648 11:109689780-109689802 TTTTATATATAGTAGGAGGTAGG - Intergenic
1088490621 11:110383955-110383977 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1088508562 11:110551011-110551033 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1088512840 11:110596114-110596136 TTTTGTATAAGGTGTGAGGAAGG - Intronic
1089090172 11:115866894-115866916 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1089939545 11:122401219-122401241 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1090104482 11:123837418-123837440 TTTTGTATAAGGTTTGAGGAAGG + Intergenic
1090116674 11:123980305-123980327 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1090151851 11:124393084-124393106 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1090524191 11:127512259-127512281 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1090569596 11:128031792-128031814 TACTTTATAAAATAGGAGGACGG + Intergenic
1090601616 11:128378286-128378308 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1090720872 11:129472005-129472027 TTTTGTATAAGGTGGAAGGAAGG - Intergenic
1090747359 11:129717483-129717505 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1090796496 11:130140174-130140196 ATGGGTATAATGGAGGAGGAGGG - Intronic
1091298970 11:134493451-134493473 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1091623000 12:2103747-2103769 TTTTGTATAAGGTATAAGGAAGG + Intronic
1091691066 12:2597878-2597900 GAGTGTATGAAGCAGGAGGAGGG - Intronic
1092316810 12:7425304-7425326 TTTTGTATAAAGTGTAAGGAAGG - Intronic
1092604893 12:10107826-10107848 TTTTGTATAAGGTATAAGGAAGG - Intronic
1092641249 12:10513067-10513089 TTTTGAATGAGGTAGGAGGACGG - Intronic
1092972531 12:13711198-13711220 TTTTGTATAAGGTATAAGGAAGG - Intronic
1093248521 12:16770200-16770222 TTTTGTATAAAGCATAAGGAAGG + Intergenic
1093270203 12:17051036-17051058 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1093309358 12:17560273-17560295 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1093340034 12:17962753-17962775 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1093403839 12:18780451-18780473 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1093498753 12:19785742-19785764 TTTTGTATATGGTACGAGGAAGG + Intergenic
1093606704 12:21099344-21099366 TTTTGTATAAAGTAAGAGATAGG + Intronic
1093660372 12:21749847-21749869 TTTTGTATAAGGTATAAGGAAGG - Intronic
1093660716 12:21753474-21753496 TAGAGAATAAGGTAGGAGGATGG + Intronic
1093835186 12:23820594-23820616 TTTTGTATAAAGTATAGGGAAGG + Intronic
1094037096 12:26083014-26083036 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1094776856 12:33739408-33739430 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1094792939 12:33935385-33935407 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
1094877541 12:34668246-34668268 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1095187049 12:39212701-39212723 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1095235638 12:39792195-39792217 TTTTGTATAAGGTATAAGGAAGG - Intronic
1095404607 12:41854228-41854250 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1095425237 12:42067929-42067951 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1095564914 12:43611790-43611812 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1095661910 12:44746268-44746290 TTTTGTATAAGGTATAAGGAAGG - Intronic
1095674725 12:44902873-44902895 TTTTGTATAAGGTATAAGGAAGG - Intronic
1095868280 12:46996770-46996792 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1096926387 12:55152618-55152640 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1096959631 12:55565307-55565329 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1096961150 12:55579032-55579054 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1097150296 12:56973259-56973281 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1097311647 12:58125501-58125523 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1097312622 12:58137171-58137193 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1097524085 12:60708401-60708423 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1097527079 12:60750439-60750461 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1097537965 12:60897722-60897744 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1097620019 12:61927981-61928003 TTTTGTATAAGGTATAAGGAAGG - Intronic
1097621119 12:61940768-61940790 TTGTGTAGAATGGAGGAAGAAGG + Intronic
1098004553 12:65982181-65982203 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1098374430 12:69798695-69798717 TTTTGTATAAGGTATAAGGAAGG + Intronic
1098380255 12:69861919-69861941 TTTTGTATAAGGTATAAGGAAGG + Intronic
1098684335 12:73399639-73399661 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1098839549 12:75462288-75462310 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1098858477 12:75681178-75681200 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1098888946 12:75988726-75988748 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1099267597 12:80466827-80466849 TTTTGTATAAGGTATAAGGAAGG - Intronic
1099489288 12:83268561-83268583 TTTTGTATAAAGTTTAAGGAGGG + Intergenic
1099618274 12:84967050-84967072 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1099626998 12:85088116-85088138 TTTTGTATAAGGTGTGAGGAAGG + Intronic
1099731468 12:86509231-86509253 TTTTGTATAAGGTGTGAGGAAGG + Intronic
1099774210 12:87103245-87103267 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1099792842 12:87358883-87358905 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1099795890 12:87398878-87398900 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1099811808 12:87592633-87592655 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1099892661 12:88609066-88609088 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1100087439 12:90929001-90929023 TTTTGTATAAGGTATAAGGAAGG - Intronic
1100238494 12:92685157-92685179 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1100264882 12:92966287-92966309 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1100943885 12:99756917-99756939 TTTTGTATATGGTATGAGGAAGG - Intronic
1100950558 12:99844410-99844432 TTTTGTATAAAGTATAAGGAAGG + Intronic
1101131475 12:101695624-101695646 TTGTGTTTCAAGCAGCAGGAAGG - Intergenic
1101206150 12:102489642-102489664 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1101298174 12:103448263-103448285 TTTTGTATAAGGTAAGAGGTGGG - Intronic
1101687454 12:107039153-107039175 TTGTGTATAGTGTAAGATGAAGG - Intronic
1101786321 12:107886704-107886726 ATGTGGATAAAGTGGGAGGGAGG + Intergenic
1102089743 12:110175971-110175993 TGGTGTGTAAAGAAGGAGGCTGG - Intronic
1102572737 12:113837150-113837172 GTGTATATTAAGTAGGAGGATGG - Intronic
1102816694 12:115871674-115871696 TGGTGGATATAGTAGGAGAAAGG + Intergenic
1104113936 12:125730756-125730778 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1104211554 12:126693338-126693360 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1105317652 13:19281699-19281721 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1105537310 13:21279418-21279440 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1105610262 13:21962615-21962637 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1105659414 13:22477149-22477171 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1105908786 13:24840731-24840753 TTGGGGGTAAAGTAGGAGGGGGG + Intronic
1106026118 13:25957091-25957113 TTTTGTATAAGGTGTGAGGAAGG - Intronic
1106094536 13:26631342-26631364 TTTTGTATAAGGTATAAGGAAGG + Intronic
1106328449 13:28717093-28717115 TTGTGTGTAAAACAGGAGGCAGG - Intronic
1106651261 13:31692651-31692673 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1106817312 13:33422915-33422937 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1106914483 13:34497918-34497940 TTCTGTATAATGTGTGAGGAAGG - Intergenic
1107091614 13:36487369-36487391 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1107333926 13:39333185-39333207 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1108049237 13:46414244-46414266 TTTTGTATAAGGTATAAGGAAGG - Intronic
1108142157 13:47435004-47435026 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1108194455 13:47978485-47978507 TTTTGTATAAAGTGTTAGGAAGG - Intronic
1108198964 13:48023757-48023779 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1108445427 13:50504209-50504231 TTTTGTATAAAGTGTAAGGAAGG + Intronic
1108487977 13:50946598-50946620 TTGTTTTAAAAGTAGGAGAAGGG + Intronic
1108544935 13:51483412-51483434 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1108577120 13:51800104-51800126 TAGGGAATAAAGGAGGAGGATGG + Intronic
1108607923 13:52058773-52058795 TTTTGTATAAGGTATAAGGAAGG - Intronic
1108636421 13:52339394-52339416 TTGTGTATAGTGTAAGGGGAGGG + Intergenic
1108857483 13:54812429-54812451 TTTTGTATAAGGTATGAGGAAGG + Intergenic
1109022207 13:57112225-57112247 TTTTGTATAAGGTATGAGGAAGG + Intergenic
1109039737 13:57316856-57316878 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1109085112 13:57961413-57961435 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1109270894 13:60253800-60253822 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1109329140 13:60905890-60905912 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1109427005 13:62178229-62178251 TTTTGTATAATGTATAAGGAAGG - Intergenic
1109571305 13:64193579-64193601 TTCTGTATAAGGTATGAGGAAGG - Intergenic
1109643422 13:65221562-65221584 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1109799042 13:67350499-67350521 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1109877259 13:68421666-68421688 TTTTGTATATAGTGGGAGGTAGG + Intergenic
1109972511 13:69787480-69787502 TTTTGTATAAAGTGTAAGGAAGG - Intronic
1109999704 13:70179491-70179513 TTGTGTACAAGGCAAGAGGATGG + Intergenic
1110128921 13:71982125-71982147 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1110137450 13:72085618-72085640 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1110199253 13:72829449-72829471 TTTTGTATAAGGTATAAGGAAGG + Intronic
1110396307 13:75033453-75033475 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1110715862 13:78703433-78703455 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1110747922 13:79078353-79078375 TTGTTTATAAGGTATGATGAGGG - Intergenic
1111017969 13:82405741-82405763 TTGTGCTTATAGTAGGAAGAGGG + Intergenic
1111092635 13:83466769-83466791 TTTTGTATAAGGTGGAAGGAAGG - Intergenic
1111621931 13:90735454-90735476 TTTTGTATAAAGTGGAAGGAAGG + Intergenic
1111646509 13:91038390-91038412 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1111723423 13:91975090-91975112 TTTTGTATAAGGTGTGAGGAAGG - Intronic
1111738137 13:92168158-92168180 TTTTGTATAAGGTATAAGGAAGG - Intronic
1111765450 13:92521597-92521619 TTTTGTATAAGGTGTGAGGAAGG - Intronic
1112145826 13:96699070-96699092 TTTTGTATAAAGTGTAAGGAAGG - Intronic
1112745925 13:102526986-102527008 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1112824387 13:103375162-103375184 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1112860583 13:103825437-103825459 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1113121689 13:106930505-106930527 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1113247707 13:108417080-108417102 TTTTGTATAAAGTGTGATGAAGG + Intergenic
1113342734 13:109442660-109442682 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1113383326 13:109824241-109824263 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1113409930 13:110076278-110076300 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1113703635 13:112409185-112409207 TTTTGTATAAGGTATAAGGAGGG - Intronic
1114360975 14:21972264-21972286 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1114579036 14:23739768-23739790 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1114692102 14:24593395-24593417 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1114724228 14:24917576-24917598 TTTTGTATATAGTATGAGGTAGG - Intronic
1114764955 14:25360428-25360450 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1114818120 14:25984155-25984177 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1114845336 14:26313870-26313892 TTTTGTATAAAGTTTAAGGAAGG - Intergenic
1114859435 14:26496664-26496686 TTTTGTATAAGGTATAAGGATGG + Intronic
1114868743 14:26630440-26630462 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1114915871 14:27264584-27264606 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1115048238 14:29024597-29024619 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1115146847 14:30236488-30236510 GGGTGTCTAAAGTAGAAGGATGG + Intergenic
1115446585 14:33497668-33497690 TTTTGTATAAAGTGTAAGGAAGG - Intronic
1115660433 14:35489117-35489139 TTTTGTATATAGTACGAGGTAGG + Intergenic
1115690506 14:35839041-35839063 TTTTGTATAAGGTATAAGGAAGG + Intronic
1115704219 14:35981870-35981892 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1115723627 14:36189504-36189526 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1115737874 14:36354278-36354300 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1115764647 14:36610978-36611000 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1115802942 14:37016213-37016235 TTTTGTATAAAGTGTAAGGAAGG + Intronic
1115832607 14:37359004-37359026 TTCTGTATAAGGTATAAGGAAGG + Intronic
1115873971 14:37839818-37839840 TTTTGTATAAGGTGGAAGGAAGG + Intronic
1115894920 14:38075575-38075597 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1115911695 14:38264069-38264091 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1116022389 14:39477179-39477201 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1116036574 14:39634710-39634732 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1116052418 14:39821197-39821219 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1116077812 14:40134414-40134436 TTTTGTATATTGTAAGAGGAAGG + Intergenic
1116308872 14:43295386-43295408 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1116385419 14:44323989-44324011 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1116412432 14:44640835-44640857 TTGTATGTGAAGGAGGAGGAAGG + Intergenic
1116533470 14:46001643-46001665 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1116545616 14:46162307-46162329 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1116560480 14:46372754-46372776 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1116565795 14:46442637-46442659 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1116571992 14:46530241-46530263 TTTTGTATAAAGTGTGAGGAAGG + Intergenic
1116641953 14:47474804-47474826 TTTTGTATAAGGTATAAGGAAGG - Intronic
1116736849 14:48702107-48702129 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1116776093 14:49182632-49182654 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1117115615 14:52507885-52507907 TTTTGTATAAGGTATAAGGAAGG - Intronic
1117201793 14:53397738-53397760 TTGTTGATAAAGTAGCAGCAGGG + Intergenic
1117614707 14:57521738-57521760 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1117624556 14:57621637-57621659 TTTTGTATAAGGTATAAGGAAGG - Intronic
1117715922 14:58581058-58581080 TTTTGTATAAGGTATGAGGAAGG + Intergenic
1117822361 14:59663236-59663258 TTTTGTATAATGTATAAGGAAGG - Intronic
1117877753 14:60273347-60273369 TTGTTTATATATTTGGAGGAAGG + Intronic
1117888088 14:60386607-60386629 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1119102082 14:71889218-71889240 GTGTGTTTGACGTAGGAGGAAGG + Intergenic
1119146930 14:72325524-72325546 TTTTGTATAAGGTGTGAGGAAGG + Intronic
1119930125 14:78537780-78537802 TTTTGTATAAGGTATAAGGAAGG + Intronic
1120042075 14:79765242-79765264 TGATTTATACAGTAGGAGGAAGG + Intronic
1120201801 14:81545582-81545604 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1120483221 14:85078523-85078545 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1120553676 14:85903086-85903108 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1120604993 14:86563766-86563788 TTTTGTATAAAGTATAAGGAAGG + Intergenic
1120666807 14:87316039-87316061 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1120675285 14:87414718-87414740 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1120797890 14:88655447-88655469 TTTTGTATAAGGTATAAGGAAGG - Intronic
1121161727 14:91749072-91749094 TTTTGTATAACGTGTGAGGAAGG - Intronic
1121697998 14:95928500-95928522 TGGTGTTTAGAGGAGGAGGAAGG - Intergenic
1121950043 14:98163687-98163709 TAGAGAAGAAAGTAGGAGGATGG - Intergenic
1122367877 14:101206003-101206025 TTTTGTATAAGGTATAAGGAGGG + Intergenic
1122377247 14:101271034-101271056 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1122472346 14:101978482-101978504 TTGTGTATAAAGTACTGGCAAGG + Intronic
1124061232 15:26295274-26295296 TTGTAATTAAAGGAGGAGGAGGG - Intergenic
1124208088 15:27740359-27740381 TTGTGTCTGAATTGGGAGGACGG - Intergenic
1124405489 15:29387939-29387961 TTTTGTATAAGGTATAAGGAAGG - Intronic
1124457947 15:29862013-29862035 TTTTGTGTATAGTATGAGGAAGG + Intronic
1124512954 15:30342360-30342382 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1124908221 15:33892397-33892419 TTCTGTATAAAGTGTAAGGAAGG + Intronic
1124914268 15:33953609-33953631 TTTTGTATAAAGTATAAGGAAGG - Intronic
1124924013 15:34053649-34053671 TTTTGTATAAGGTATAAGGAAGG - Intronic
1125048847 15:35274223-35274245 TTTTGTATAAGGTATAAGGAAGG - Intronic
1125084652 15:35715831-35715853 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1125210940 15:37214552-37214574 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1125373771 15:39005997-39006019 TTTTGTATAAAGTGTGAGGAAGG - Intergenic
1125396881 15:39258629-39258651 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1125397260 15:39262749-39262771 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1125454038 15:39839448-39839470 TTTTGTATAAGGTGTGAGGAAGG - Intronic
1126051379 15:44688681-44688703 TTTTGTATAAAGTGTAAGGAAGG - Intronic
1126201025 15:45986268-45986290 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1126381725 15:48055193-48055215 TTTTGTATAAGTTATGAGGAAGG - Intergenic
1126508342 15:49435091-49435113 TTGTGTATGAAGTGAGAGGGGGG + Intronic
1126884642 15:53136615-53136637 TTTTGTATAAAGTATAAGGAAGG + Intergenic
1126910978 15:53416568-53416590 TTGTTTATAAAGTAAGAGCCAGG - Intergenic
1126966437 15:54059937-54059959 TTTTGTATAAGGTATAAGGAAGG - Intronic
1127171589 15:56308722-56308744 TTTTGTATAGTGTATGAGGAAGG + Intronic
1127217727 15:56842460-56842482 TTGTTTATAATCTAAGAGGAAGG + Intronic
1127355802 15:58198362-58198384 TTTTGTATAAGGTATAAGGAAGG - Intronic
1127371643 15:58346981-58347003 TTTTGTATAAGGTATAAGGAAGG + Intronic
1127758444 15:62114797-62114819 TAGTTTAAAAAGTAGGAGTATGG - Intergenic
1128416312 15:67449395-67449417 TTTTGTATAAGGTATAAGGAAGG + Intronic
1128873114 15:71178961-71178983 TTTTGTATAAGGTGGAAGGAAGG - Intronic
1129012116 15:72429532-72429554 TTTTGTATAAGGTGGAAGGAAGG + Intergenic
1129508370 15:76101970-76101992 ATCTGTATGCAGTAGGAGGAAGG - Intronic
1129588415 15:76892144-76892166 TTTTGTATAAAGTGTAAGGAAGG - Intronic
1130129208 15:81123209-81123231 TTTTGTATATAGTGTGAGGAAGG + Intronic
1130200662 15:81823517-81823539 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1130777673 15:87002149-87002171 TTTTGTATAAGGTATAAGGAAGG + Intronic
1130802175 15:87276487-87276509 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1130848749 15:87772844-87772866 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1131385124 15:91999425-91999447 ATGGGTATAAAATAGGAAGAGGG + Intronic
1131444692 15:92487969-92487991 TTTTGTATAAGGTGTGAGGAAGG - Intronic
1131933551 15:97474688-97474710 TTTTGTATATAGTATAAGGAAGG - Intergenic
1133870944 16:9685574-9685596 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1134586196 16:15413532-15413554 TTGTGGACAAAGAAAGAGGAAGG - Intronic
1136620144 16:31423230-31423252 TTGTGGATAAAGTTGGAAGTTGG + Intronic
1136865545 16:33749467-33749489 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1137000581 16:35226596-35226618 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1137025846 16:35473499-35473521 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1137045138 16:35648924-35648946 TTGTGTATAAAGTGTAAGGAAGG - Intergenic
1137226796 16:46520496-46520518 TTGGGCATAGAGTAGAAGGATGG - Intergenic
1137371906 16:47914816-47914838 TTTTGTATAAAGTGTAAGGACGG - Intergenic
1137412567 16:48241865-48241887 TTTTGTATAAGGTATAAGGAAGG - Intronic
1137438044 16:48473688-48473710 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1137880450 16:52040756-52040778 TTGGGTATATAGTATGAGTAAGG + Intronic
1137914992 16:52420317-52420339 TTATGTGTAAAGTTGGAGAAGGG + Intergenic
1138264253 16:55648544-55648566 TTTTGTATAAGGTATGAGGTAGG - Intergenic
1138752999 16:59446767-59446789 TTTTGTATATAGTACAAGGAAGG + Intergenic
1138824916 16:60307560-60307582 TTTTGTATAAATTAGGAGACTGG - Intergenic
1138914883 16:61451656-61451678 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1139004467 16:62553549-62553571 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1139617119 16:68103714-68103736 TTTTGTATATGGTATGAGGAAGG + Intronic
1139837360 16:69849991-69850013 CTGGTTATAAACTAGGAGGAAGG + Intronic
1140537518 16:75724094-75724116 TTTTGTATAAAGTGTAAGGAAGG - Intronic
1140937242 16:79684706-79684728 CTGAGTAGAAAGTCGGAGGAAGG + Intergenic
1141261245 16:82455674-82455696 TTATGTATACAGAAGCAGGAAGG - Intergenic
1141791402 16:86238117-86238139 TTTTGTATAAGGTGGAAGGAAGG - Intergenic
1141795087 16:86267004-86267026 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1203106605 16_KI270728v1_random:1366645-1366667 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1203126909 16_KI270728v1_random:1595723-1595745 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1142532672 17:593129-593151 TTTTGTATAAAGTGTAAGGAAGG - Intronic
1142798078 17:2324666-2324688 GTGGGTATGAAGGAGGAGGATGG - Exonic
1142936555 17:3338442-3338464 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1143652711 17:8273756-8273778 TTGTGGATAAAGAAGAAAGATGG - Intergenic
1145201216 17:20946771-20946793 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1145408741 17:22636422-22636444 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1145715218 17:27013116-27013138 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
1146148148 17:30440580-30440602 TTTTGTATAAGGTATAAGGAAGG + Intronic
1146245445 17:31277865-31277887 TTATGTATAAAGGAGAAGGCAGG - Intronic
1146274179 17:31504735-31504757 TTGAGGATAAACAAGGAGGATGG - Intronic
1146613883 17:34335589-34335611 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1146665391 17:34699167-34699189 ATGTGGATAGAGTGGGAGGAAGG + Intergenic
1146760415 17:35472231-35472253 TTTTGTATAAAGTGTAAGGAAGG + Intronic
1146802117 17:35833283-35833305 GTGGGTATAGAGTAGGAGGGCGG + Intronic
1147512783 17:41086083-41086105 TTTTGTATAAAGTGTAAGGAAGG + Intronic
1147525868 17:41222406-41222428 TTTTGTATAAAGTGTAAGGAAGG - Intronic
1147691542 17:42318456-42318478 TTATGTATAAAATAAGAGGGAGG + Intronic
1149054956 17:52352437-52352459 TTTTGTATAAGGTAAAAGGAAGG + Intergenic
1149114433 17:53074973-53074995 TTTTGTATATAGTACAAGGAAGG + Intergenic
1149166742 17:53761103-53761125 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1149366275 17:55948140-55948162 TTTTGTATAATGTATAAGGAAGG + Intergenic
1150189923 17:63227775-63227797 TTTTGTATAAGGTATAAGGAAGG + Intronic
1150524211 17:65904923-65904945 TTTTGTATAAAGTGTAAGGAAGG - Intronic
1150772607 17:68054380-68054402 TGCTGTAGAGAGTAGGAGGAGGG + Intergenic
1151108513 17:71647746-71647768 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1153158957 18:2181016-2181038 TTCTGTCTTAGGTAGGAGGAAGG + Intergenic
1153226327 18:2902820-2902842 TTGTGTGTGAAGGAGCAGGAGGG + Intronic
1153561789 18:6378489-6378511 TTTTGTATAAGGTATAAGGAAGG + Intronic
1153788410 18:8555483-8555505 GTGTGCATAAAGCAGGATGAGGG - Intergenic
1153974587 18:10257125-10257147 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
1155102062 18:22621187-22621209 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1155330568 18:24711987-24712009 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1155478519 18:26260452-26260474 TTTTGTATAAGGTATAAGGAAGG + Intronic
1155568062 18:27159279-27159301 TTTTGTATAAGGTATAAGGAAGG + Intronic
1155758434 18:29532436-29532458 TTTTGTATATAGTATAAGGAAGG - Intergenic
1155825827 18:30441380-30441402 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1155911381 18:31508097-31508119 TTTTGTATAAAGTGTAAGGAAGG + Intronic
1156038942 18:32797338-32797360 TTTTGTATAAGGTATGAGGAAGG - Intergenic
1156071629 18:33218622-33218644 TTTTGTATAAGGTATAAGGAAGG + Intronic
1156158926 18:34335941-34335963 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1156280499 18:35632520-35632542 TTTTGTATAAGGTATAAGGAAGG - Intronic
1156304905 18:35868615-35868637 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1156353094 18:36317897-36317919 TTTTGTATAAGGTATAAGGAAGG + Intronic
1156417307 18:36910292-36910314 TTTTGTATAAAGTGTAAGGAAGG + Intronic
1156433115 18:37097244-37097266 TTTTGTATAAGGTGTGAGGAAGG + Intronic
1156512198 18:37647465-37647487 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1156884969 18:42124472-42124494 TTTTGTATAAGGCATGAGGAAGG - Intergenic
1157019825 18:43767214-43767236 TTTTGTATATGGTAGAAGGAAGG + Intergenic
1158081125 18:53592021-53592043 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1158271017 18:55716669-55716691 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1158365130 18:56725825-56725847 TTTTGTATAAGGTATAAGGAAGG + Intronic
1158550872 18:58434947-58434969 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1158971921 18:62676143-62676165 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1159172080 18:64783861-64783883 TTTTGTATAAGGTGGAAGGAAGG - Intergenic
1159620251 18:70629132-70629154 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1159644182 18:70898093-70898115 TTGTGGAGAAAGTTGGAGGTGGG - Intergenic
1160639668 19:118142-118164 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1161517561 19:4704692-4704714 TTGTGAATAGGGTAGGAGGGTGG - Intronic
1161793722 19:6375000-6375022 TTGTGAATAAAGTTGGGGAATGG + Exonic
1161919385 19:7254837-7254859 GTGAGTATCAGGTAGGAGGAAGG + Intronic
1162642039 19:12018563-12018585 TTGTTTGTAAAGTGGGAGTACGG + Intronic
1163180627 19:15598262-15598284 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1164110816 19:22156692-22156714 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1164195534 19:22954484-22954506 TTTTGTATAAAGTATAAGGAAGG - Intergenic
1164326648 19:24198948-24198970 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1164348216 19:27295453-27295475 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1164360636 19:27504386-27504408 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
1164377035 19:27696611-27696633 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1164395995 19:27863675-27863697 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1164717018 19:30399586-30399608 TTTTGTATAAGGTATAAGGAAGG + Intronic
1164879308 19:31717658-31717680 TTTTATATAAAGCAGGAGAAGGG + Intergenic
1165254137 19:34563365-34563387 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1165969965 19:39619661-39619683 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1166440145 19:42806622-42806644 TTTTGTATAAAGTGTAAGGAAGG + Intronic
1166442923 19:42831733-42831755 ATGAGAAGAAAGTAGGAGGAGGG - Intronic
1166462608 19:43002495-43002517 ATGAGAAGAAAGTAGGAGGAGGG - Intronic
1166613511 19:44221933-44221955 TTTTGTATAAAGTGTAAGGAAGG + Intronic
1166887719 19:45972168-45972190 GTGTGTAAAAAGGAGAAGGAAGG - Intronic
1167474543 19:49692144-49692166 CTGGGTATGAAGGAGGAGGAGGG + Intronic
1167771654 19:51524267-51524289 ATGTGTTAAAAGTAAGAGGAGGG + Intronic
1168372295 19:55846192-55846214 TTTTGTATAAGGTATAAGGAAGG + Intronic
925431219 2:3795538-3795560 TTTTGTATAAGGTGTGAGGAAGG + Intronic
925432809 2:3810750-3810772 TTTTGTATAAGGTATAAGGAAGG + Intronic
925471179 2:4162649-4162671 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
925537618 2:4934383-4934405 TTGCCTATAAAATAGCAGGACGG - Intergenic
926319270 2:11737204-11737226 TTTTGTATAAAGTGTAAGGAAGG - Intronic
926339877 2:11896133-11896155 TGGTGTAGGAAGAAGGAGGATGG + Intergenic
926484779 2:13440906-13440928 TTTTGTATAAAGTGAAAGGAAGG + Intergenic
926499512 2:13636131-13636153 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
926533929 2:14086564-14086586 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
926535376 2:14104102-14104124 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
926651056 2:15345976-15345998 TTTTGTATAAAGTGTAAGGAAGG - Intronic
926941331 2:18140318-18140340 TTTTGTATAAAGTGTAAGGAAGG + Intronic
926988203 2:18647236-18647258 TTATGTAGGAGGTAGGAGGAAGG - Intergenic
927165201 2:20313034-20313056 TTTTGTATAAGGTATAAGGAAGG - Intronic
927306834 2:21583302-21583324 TTTTGTATAAGGTATAAGGAAGG + Intergenic
927610325 2:24532623-24532645 TTTTGTATAAGGTATAAGGAAGG + Intronic
927871310 2:26625905-26625927 TTTTGTATAAGGTATAAGGAAGG + Intronic
928119343 2:28571762-28571784 TTTTGTATAAAGTGTGAGGTAGG - Intronic
928386687 2:30875100-30875122 TTTTGTATAAGGTGGGAGAAAGG + Intergenic
928472831 2:31590906-31590928 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
928475731 2:31625531-31625553 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
928480591 2:31679260-31679282 TTTTGTATACAGTGTGAGGAAGG + Intergenic
928492655 2:31800267-31800289 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
928634892 2:33234870-33234892 TTTTGTATAATGTGTGAGGAAGG - Intronic
928693717 2:33826860-33826882 TTTTGTATAAGGTATAAGGAAGG + Intergenic
929064288 2:37957816-37957838 TTTTGTATAAGGTATAAGGAAGG + Intronic
929212454 2:39372759-39372781 TTTTGTATATGGTAAGAGGAAGG - Intronic
929255668 2:39808863-39808885 TTTTGTATAAGGTATAAGGAAGG + Intergenic
929257288 2:39826159-39826181 TTTTGTATAAGGTATAAGGAAGG + Intergenic
929276131 2:40026782-40026804 TTTTGTATAAGGTATAAGGAAGG - Intergenic
929331310 2:40684512-40684534 TTTTGTATAAGGTATAAGGAAGG - Intergenic
929332000 2:40693369-40693391 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
929355379 2:41017121-41017143 TTTTGTATAAGGTATAAGGAAGG + Intergenic
929415175 2:41739901-41739923 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
930030107 2:47053211-47053233 TTGGGTTTTAAGTAGGAAGAGGG + Intronic
930276412 2:49316391-49316413 TTTTGTATAAGGTATAAGGAAGG - Intergenic
930346436 2:50188343-50188365 TTTTGTATAAGGTATAAGGAAGG - Intronic
930433673 2:51313876-51313898 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
930526397 2:52535850-52535872 TTTTGTATAAGGTATAAGGAAGG - Intergenic
930548318 2:52798623-52798645 TTTTGTATAAGGTATAAGGAAGG - Intergenic
930569674 2:53069680-53069702 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
930658665 2:54032296-54032318 TTTTGTATAAAGTGTAAGGAAGG + Intronic
930929773 2:56867549-56867571 TTTTGTATAAAGTGTTAGGAAGG - Intergenic
930941317 2:57017673-57017695 TTTTGTATAAGGTATAAGGAAGG + Intergenic
930979802 2:57510100-57510122 ATATGTGTAAAGAAGGAGGATGG + Intergenic
931013821 2:57951455-57951477 TAGTTTATAAAGTAGCAGCAGGG + Intronic
931024481 2:58093835-58093857 TTTTGTATAAAGTGTAAGGAAGG + Intronic
931211172 2:60196822-60196844 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
931468786 2:62516691-62516713 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
931481602 2:62646885-62646907 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
931558925 2:63535682-63535704 TTTTGTATAAAGTGTAAGGAAGG - Intronic
931835598 2:66095697-66095719 TTTTGTATAAAGTGAAAGGAAGG + Intergenic
931950964 2:67361071-67361093 TTTTGTATAAGGTATAAGGAAGG - Intergenic
931974161 2:67624483-67624505 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
932013987 2:68005805-68005827 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
932080757 2:68712679-68712701 TTTTGTATAAAGTGTAAGGAAGG + Intronic
932363369 2:71129320-71129342 TTGTGTATCACCTAAGAGGAAGG + Intronic
932649839 2:73543336-73543358 TTTTGTATAAGGTATAAGGAAGG - Intronic
933046555 2:77545163-77545185 TTTTGTATAAAGTATAAGGAAGG - Intronic
933093653 2:78151270-78151292 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
933117534 2:78493579-78493601 TTTTGTATAAAGTGCAAGGAAGG + Intergenic
933127236 2:78623938-78623960 TTTTGTATAAGGTATAAGGAAGG - Intergenic
933202296 2:79465154-79465176 TTTTGTATAAAGTGTAAGGAAGG + Intronic
933257146 2:80094176-80094198 TTTTGTATAAGGTATAAGGAAGG + Intronic
933266577 2:80187309-80187331 TAATTTATAACGTAGGAGGAGGG + Intronic
933360034 2:81270116-81270138 TTTTGTATAAGGTATAAGGAAGG - Intergenic
933381783 2:81557507-81557529 TTTTGTATAAGGTATAAGGAAGG + Intergenic
933412747 2:81946354-81946376 TTTTGTATAAGGTATAAGGAAGG + Intergenic
933999805 2:87699170-87699192 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
934634070 2:95966338-95966360 TTTTGTATAAAGTGTAAGGAAGG + Intronic
934796628 2:97106226-97106248 TTTTGTATAAGGTATAAGGAAGG - Intergenic
934799559 2:97138901-97138923 TTTTGTATAAAGTGTAAGGAAGG - Intronic
934833882 2:97564548-97564570 TTTTGTATAAAGTGTAAGGAAGG + Intronic
934997896 2:98982827-98982849 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
935107467 2:100058655-100058677 TTTTGTTTATAGTACGAGGAAGG - Intronic
935484226 2:103632980-103633002 TTTTGTATAAGGTATAAGGAAGG + Intergenic
935557806 2:104529444-104529466 TTTTGTATAAAGTGCAAGGAAGG - Intergenic
935937077 2:108197759-108197781 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
936642790 2:114334280-114334302 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
936848567 2:116868480-116868502 TTCTGTATAAGGTATAAGGAAGG + Intergenic
936910362 2:117584645-117584667 TTTTGTATAAGGTATAAGGAAGG - Intergenic
936943190 2:117906616-117906638 TTTTGTATAAGGTATAAGGAAGG + Intergenic
936967154 2:118138165-118138187 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
936995957 2:118414530-118414552 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
937194811 2:120143935-120143957 TTATGTATAAAATAGGATAATGG + Intronic
937233046 2:120411880-120411902 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
937846101 2:126580743-126580765 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
938059643 2:128242265-128242287 TTGTGTTTCTAGCAGGAGGAGGG + Intronic
938433835 2:131270373-131270395 TTTTGTATAAAGTGTAAGGAAGG - Intronic
938651070 2:133384227-133384249 TTTTGTATAAAGTGTAAGGAAGG + Intronic
938834708 2:135089061-135089083 TTTTGTATAAGGTATAAGGAAGG + Intronic
939074447 2:137583509-137583531 TTTTGTATAAGGTGTGAGGAAGG + Intronic
939099818 2:137882596-137882618 TTTTGTATAGGGTATGAGGAGGG + Intergenic
939111143 2:138008746-138008768 TTTTGTATATAGTATAAGGAAGG - Intronic
939367447 2:141251402-141251424 TTGTGGATAATAAAGGAGGAGGG + Intronic
939544633 2:143537549-143537571 TTTTGTATAAAGTGTAAGGAGGG + Intronic
939647647 2:144720659-144720681 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
940036690 2:149319574-149319596 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
940045349 2:149403903-149403925 TTTTGTATAAAGTGTAAGGAAGG + Intronic
940077056 2:149754049-149754071 TTTTGTATAAGGTATAAGGAAGG - Intergenic
940098817 2:150009888-150009910 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
940426722 2:153539563-153539585 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
940720316 2:157275001-157275023 TTTTGTATAAAGTGTAAGGAAGG + Intronic
940814495 2:158283099-158283121 TTTTGTATAAGGTGTGAGGAAGG - Intronic
940942719 2:159580887-159580909 TTTTGTATAAGGTGTGAGGAAGG - Intronic
940964977 2:159826929-159826951 TTTTGTATAAGGTGTGAGGAAGG - Intronic
941267379 2:163379319-163379341 TTTTGTATAAGGTATAAGGAAGG + Intergenic
941437581 2:165490769-165490791 TTTTGTATAAAGTGTAAGGAAGG - Intronic
941569687 2:167154578-167154600 TTTTGTATAAAGTGTAAGGAAGG + Intronic
941681841 2:168408208-168408230 TTTTGTATAAGGTATAAGGAAGG + Intergenic
941970996 2:171351134-171351156 TTTTGTATAAGGTATAAGGAAGG + Intronic
942272510 2:174290916-174290938 TTTTGTATAAGGTATAAGGAAGG - Intergenic
942378840 2:175365752-175365774 TCGGGGAGAAAGTAGGAGGAAGG + Intergenic
942429502 2:175895305-175895327 TTTTGTATAAGGTATAAGGAAGG - Intergenic
942731185 2:179062354-179062376 TTTTGTATAAGGTATAAGGAAGG + Intergenic
942815909 2:180053929-180053951 TTTTGTATAAGGTATAAGGAAGG - Intergenic
942874911 2:180783580-180783602 TTTTGTATAAAGTGAAAGGAAGG + Intergenic
942992416 2:182217238-182217260 TTTTGTATAAGGTATAAGGAAGG - Intronic
943007385 2:182402495-182402517 TTCTGTATAAGGTATAAGGAAGG - Intronic
943081418 2:183262494-183262516 TTTTGTATAAGGTATAAGGAAGG - Intergenic
943209310 2:184942421-184942443 GTATGTATAAAGTAAGATGATGG - Intergenic
943324019 2:186476582-186476604 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
943499568 2:188670162-188670184 TTTTGTATAAGGTATAAGGAAGG - Intergenic
943517035 2:188901613-188901635 TAGTGTATAAACTTGGAGTAGGG + Intergenic
943598653 2:189888127-189888149 TTTTGTATAAGGTATAAGGAAGG + Intronic
943794361 2:191973012-191973034 TGATATCTAAAGTAGGAGGAAGG + Intronic
943871457 2:193006243-193006265 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
943915989 2:193633112-193633134 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
944038637 2:195329132-195329154 TTTTGTATAAAGCACAAGGAAGG - Intergenic
944163212 2:196688915-196688937 TTTTGTATAAGGTATAAGGAAGG + Intronic
944439757 2:199730171-199730193 TTTTGTATAAGGTATAAGGAAGG - Intergenic
944570287 2:201037712-201037734 TTTTGTATAAGGTATAAGGAAGG - Intronic
944950873 2:204747148-204747170 TTTTGTATAAAGTGTAAGGAAGG + Intronic
944955296 2:204800882-204800904 TTTTGTATAAGGTATAAGGAAGG + Intronic
945317347 2:208384003-208384025 TTGTGTAGAAGTTAGGAGTAGGG + Intronic
945369235 2:208995992-208996014 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
945388168 2:209229091-209229113 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
945397187 2:209333388-209333410 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
945400315 2:209373972-209373994 TTTTGTATAAGGTATAAGGAAGG - Intergenic
945441474 2:209885182-209885204 TTGAGAATAAAGTATGAGCAAGG + Intronic
945479991 2:210334296-210334318 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
945533463 2:210984381-210984403 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
945603210 2:211893380-211893402 TTTTGTATAAAGTGTAAGGAAGG - Intronic
945676433 2:212860527-212860549 TTTTGTATAAGGTATAAGGAAGG - Intergenic
945714854 2:213345551-213345573 TTTTGTATAAGGTGTGAGGAAGG + Intronic
945716870 2:213367958-213367980 TTTTGTATAAGGTGTGAGGAAGG + Intronic
945781088 2:214173268-214173290 TTTTGTATAAGGTGTGAGGAAGG + Intronic
945927869 2:215824285-215824307 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
946476962 2:220016248-220016270 TTTTGTATAAGGTATAAGGAAGG + Intergenic
946546337 2:220748667-220748689 ATTTGTATGAAGAAGGAGGAAGG + Intergenic
946901252 2:224374040-224374062 TTGTGTCTCAAGGAGTAGGAAGG - Intergenic
946907175 2:224428640-224428662 TTGTGTATAAAGAGAGAGAATGG - Intergenic
947094208 2:226547594-226547616 TTCTGTATAAAAGAGGTGGAAGG - Intergenic
947283458 2:228482361-228482383 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
947440157 2:230113230-230113252 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
947688217 2:232109686-232109708 TTGTGTATATAGTGTAAGGAAGG - Intronic
948040005 2:234893223-234893245 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
948823718 2:240564219-240564241 TTGTGAAGAAAGCAGTAGGAAGG - Intronic
1168743347 20:213907-213929 TTGTGTGTAAAGCATGAGGGAGG - Intergenic
1168882763 20:1222127-1222149 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1169010195 20:2244070-2244092 TTTTGTATATGGTAGGTGGAGGG - Intergenic
1169064088 20:2683770-2683792 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1169175868 20:3513279-3513301 TTTTGTATAAAGTGTAAGGAAGG + Intronic
1169177105 20:3526900-3526922 TTTTGTATAAGGTATAAGGAAGG - Intronic
1169695231 20:8380135-8380157 TTTTGTATAAGGTAGGAGGAAGG + Intronic
1169767969 20:9169196-9169218 TTGTGTGTTAAGTGAGAGGAAGG - Intronic
1169940509 20:10932283-10932305 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1170173219 20:13438475-13438497 TTTTGTATAAGGTATAAGGAAGG - Intronic
1170179428 20:13512772-13512794 TTTTGTATAAAGTGTAAGGAAGG + Intronic
1170197656 20:13706557-13706579 TTCTGTATAAGGTATAAGGAAGG - Intergenic
1170267574 20:14484975-14484997 TTGGGTATAATGTAGGAGTGGGG + Intronic
1170543830 20:17415995-17416017 TTTTGTATAAGGTATAAGGAAGG - Intronic
1170707337 20:18756440-18756462 TTTTGTATAAGGTATAAGGAAGG + Intronic
1170974196 20:21146720-21146742 TTGTTTTTATAGTAGGAGGAAGG + Intronic
1171090138 20:22277298-22277320 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1171155650 20:22870760-22870782 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1171246749 20:23616522-23616544 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1171362113 20:24594202-24594224 TCGTGTATACAGTGTGAGGAAGG + Intronic
1171722063 20:28572999-28573021 TTTTGTATAAGGTGGAAGGAAGG + Intergenic
1171756024 20:29110509-29110531 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1171842457 20:30231180-30231202 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1171912016 20:30971624-30971646 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1171913555 20:30990281-30990303 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1171913723 20:30992346-30992368 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1173043201 20:39484891-39484913 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1173090904 20:39970325-39970347 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1173236227 20:41248058-41248080 TTGGGTGTAAAGTATAAGGAGGG - Intronic
1174776429 20:53347071-53347093 TTTTGTATAAGGTAGGGTGAGGG - Intronic
1174845698 20:53941120-53941142 GTGTGTGTGAAGTGGGAGGAGGG + Intronic
1174989465 20:55493666-55493688 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1174990291 20:55501514-55501536 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1175023800 20:55880209-55880231 TTCTGTAGCAAGTAGGAGGTTGG + Intergenic
1175555848 20:59855890-59855912 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1176764094 21:12998304-12998326 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1176916677 21:14634132-14634154 TTTTGTATAAGGTATAAGGAAGG - Intronic
1177143518 21:17382964-17382986 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1177201281 21:17959088-17959110 TTTTTTAGAAAGCAGGAGGAAGG + Intronic
1177378312 21:20303226-20303248 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1177459569 21:21393116-21393138 TTTTGTATACAGTATAAGGAAGG + Intronic
1177491929 21:21837921-21837943 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1177506797 21:22029735-22029757 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1177708174 21:24736537-24736559 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1178557985 21:33610552-33610574 TTATTTATAAATCAGGAGGATGG - Intronic
1178812556 21:35897536-35897558 TTGTGTATAAGGTGTAAGGAAGG - Intronic
1180295616 22:10931682-10931704 TTTTGTATAAGGTGGAAGGAAGG + Intergenic
1180397278 22:12364666-12364688 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1180399276 22:12393805-12393827 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1180402442 22:12499470-12499492 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1180598624 22:16997816-16997838 TTTTGTATAAGGTACAAGGAAGG + Intronic
1180667040 22:17521922-17521944 TTTTGTATAAGGTATAAGGAAGG + Intronic
1181081129 22:20416275-20416297 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1182168039 22:28196257-28196279 TTTTGTATAAGGTATAAGGAAGG - Intronic
1182169642 22:28214100-28214122 TTTTGTATAAGGTATAAGGAAGG - Intronic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1182704383 22:32267292-32267314 ATGTGAATAAGGTGGGAGGAGGG + Intergenic
1183006306 22:34905521-34905543 TGGTGTCTGAAGCAGGAGGAGGG + Intergenic
1183006881 22:34910963-34910985 TTGGGTATAAAGGAAGAGGTGGG + Intergenic
1184484240 22:44766305-44766327 TTGTCTATACTGGAGGAGGAAGG + Intronic
949147363 3:718726-718748 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
949446196 3:4136441-4136463 TTTTGTATAAGGTGTGAGGAAGG - Intronic
949450457 3:4179506-4179528 TTTTGTATAAGGTGTGAGGAAGG - Intronic
949529668 3:4942372-4942394 TTCTTAATAAAATAGGAGGATGG + Intergenic
949581827 3:5396298-5396320 TTTTGTATAAGGTATAAGGAAGG + Intergenic
949593092 3:5514094-5514116 TTTTGTATAAGGTATAAGGAAGG - Intergenic
949593366 3:5516919-5516941 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
949600402 3:5591973-5591995 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
949640596 3:6031622-6031644 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
949706122 3:6818682-6818704 TTATGTGTAAAGTGAGAGGAGGG - Intronic
949846550 3:8376849-8376871 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
949912777 3:8926879-8926901 TTTTGTATAAGGTATAAGGAAGG - Intronic
950063533 3:10092454-10092476 TTGTGGCATAAGTAGGAGGAAGG - Intronic
950292549 3:11797466-11797488 TTTTGTATATGGTATGAGGAAGG - Intronic
950947527 3:16965190-16965212 TTTTGTATAAGGTATAAGGAAGG + Intronic
950998639 3:17531805-17531827 TTTTGTATAAAGTGTAAGGAAGG - Intronic
951138976 3:19139154-19139176 TTGAGTATAAATTTTGAGGATGG + Intergenic
951175243 3:19591434-19591456 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
951323759 3:21278129-21278151 TTTTGTATAAGGTATAAGGAAGG - Intergenic
951364967 3:21770057-21770079 TTTTGTATAAGGTATAAGGAAGG - Intronic
951413650 3:22396434-22396456 TTTTGTATAAGGTATAAGGAAGG + Intergenic
951672201 3:25197236-25197258 TTGTGTATAAGGTGTAAGGAAGG + Intronic
951792031 3:26496640-26496662 TTTGGTATAAAGTGTGAGGAAGG - Intergenic
951827096 3:26880818-26880840 TTTTGTATAAGGTATAAGGAAGG - Intergenic
951833360 3:26954809-26954831 TTTTGTATAAGGTATGAGGAAGG + Intergenic
951897214 3:27621273-27621295 TTTTGTATAACGTATAAGGAAGG + Intergenic
951899387 3:27642036-27642058 TTGTTTATGAGGTAGGAGTAGGG + Intergenic
951921328 3:27857738-27857760 TTTTGTATAAGGTAAAAGGAAGG - Intergenic
952104644 3:30055082-30055104 TTTTGTATAAGGTATAAGGAAGG - Intergenic
952437071 3:33282217-33282239 TTTTGTATAAGGTATAAGGAAGG + Intronic
952441864 3:33338747-33338769 TTTTGTATATAGTAAAAGGAAGG - Intronic
952607542 3:35168151-35168173 TTTTGTATAAAGTGTGAGGAAGG + Intergenic
952987850 3:38802619-38802641 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
953146082 3:40276313-40276335 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
953287103 3:41621584-41621606 TTTTGTATAAAGTGTAAGGAAGG - Intronic
953316323 3:41930309-41930331 TTTTGTATAGAGTATAAGGAAGG - Intronic
953585120 3:44193092-44193114 TATTGTATAAAGTATGAGGTAGG + Intergenic
953639547 3:44693541-44693563 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
953652234 3:44817411-44817433 TTTTGTATAAAGTGTAAGGAAGG + Intronic
954833296 3:53441909-53441931 TTTTGTATAAGGTATAAGGAAGG + Intergenic
955119113 3:56037918-56037940 TTTTGTATAAGGTGTGAGGAAGG - Intronic
955321512 3:57977912-57977934 TTGTGTAAAAAGGTGGAGCAAGG - Intergenic
955627123 3:60930186-60930208 TTTTGTATAAGGTATAAGGAAGG - Intronic
956076763 3:65514128-65514150 TTTTGTATAAGGTATAAGGAAGG - Intronic
956215828 3:66847751-66847773 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
956243868 3:67159239-67159261 TTGTGTATAGGGTATAAGGAAGG - Intergenic
956477743 3:69641017-69641039 TTTTGTATATAGTATAAGGAAGG - Intergenic
956497543 3:69844441-69844463 TTTTGTATAAGGTATAAGGAAGG - Intronic
956588977 3:70893651-70893673 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
956918834 3:73904488-73904510 TTTTGTATAAGGTGGAAGGAAGG - Intergenic
956920282 3:73920992-73921014 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
956985118 3:74689757-74689779 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
957020498 3:75121022-75121044 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
957206997 3:77211745-77211767 TTTTGTATAAAGTGTAAGGAAGG + Intronic
957280579 3:78146144-78146166 TTTTGTATACAGTAAGAGGCAGG + Intergenic
957491384 3:80932004-80932026 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
957493900 3:80965870-80965892 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
957650527 3:82996906-82996928 TTTTGTATAAAATATAAGGAAGG - Intergenic
957746151 3:84346157-84346179 TTTTGTATATAGTATAAGGAAGG - Intergenic
957750132 3:84404245-84404267 TTTTGTATAAGGTATGAGGAAGG + Intergenic
957751339 3:84421095-84421117 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
957763661 3:84592873-84592895 TTTTGTATAAGGTATAAGGAAGG + Intergenic
958263054 3:91404572-91404594 TTGTGTATAAAGAGGGATCATGG - Intergenic
958467586 3:94476746-94476768 TTTTGTATAAAGTTTAAGGAAGG - Intergenic
958694121 3:97506353-97506375 TTTTGTATAAAGTGTAAGGAAGG + Intronic
958725898 3:97905915-97905937 TTTTGTATAAGGTATAAGGAAGG + Intronic
958742429 3:98091260-98091282 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
958828389 3:99059834-99059856 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
958861931 3:99455008-99455030 TTTTGTATAAGGTATAAGGAAGG - Intergenic
958874907 3:99604967-99604989 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
958944852 3:100351577-100351599 TTTTGTATAAAGTGTAAGGAAGG - Intronic
958977784 3:100686546-100686568 TTTTGTATAAGGTATAAGGAAGG + Intronic
959022154 3:101199338-101199360 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
959147518 3:102566885-102566907 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
959250143 3:103931375-103931397 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
959298935 3:104574923-104574945 TTTTGTATAAGGTATAAGGAAGG + Intergenic
959306668 3:104675884-104675906 TTTTGTATATAGTATAAGGAGGG + Intergenic
959365525 3:105453243-105453265 TTCTGTATAAGGTATAAGGAAGG + Intronic
959454214 3:106539015-106539037 TTTTGTATAAGGTATAAGGAAGG - Intergenic
959522748 3:107338675-107338697 TTTTGTATAAGGTATAAGGAAGG - Intergenic
959607947 3:108262511-108262533 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
959609121 3:108274634-108274656 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
959687526 3:109163771-109163793 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
959724280 3:109526310-109526332 TTTTGTATAAGGTATAAGGAAGG - Intergenic
959741634 3:109727127-109727149 TTTTGTATAAGGTATAAGGAAGG + Intergenic
959797238 3:110444922-110444944 TTTTGTATAAAGTGTAAGGAGGG - Intergenic
959846141 3:111035969-111035991 TGGTGTACAAAGGAGGAGAAAGG - Intergenic
959863405 3:111240819-111240841 TTTTGTATAAAGTGTAAGGAAGG + Intronic
960265162 3:115613177-115613199 TTTTGTATAAGGTATAAGGAAGG - Intergenic
960405256 3:117252061-117252083 TTTTCTATAAATTAAGAGGAAGG - Intergenic
960642966 3:119846119-119846141 TTTTGTATAAGGTATAAGGAAGG - Intronic
960770571 3:121189392-121189414 TTTTGTATAAAGTGTAAGGAAGG + Intronic
960771067 3:121192792-121192814 TTTTGTATAAAGTGTAAGGAAGG - Intronic
961745231 3:129060323-129060345 TTGAGTATACAGGAGGAGGGAGG + Intergenic
962068684 3:132010773-132010795 TTGGCTATAAAGTGGGAGGAGGG - Intronic
962157239 3:132960852-132960874 TTTTGTATAAGGTATAAGGAAGG - Intergenic
962299274 3:134223557-134223579 TTGTTTATAAAAAGGGAGGAGGG + Intronic
962553629 3:136523765-136523787 TTTTGTATAAAGTATAAGGAAGG + Intronic
962675621 3:137755667-137755689 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
962785523 3:138764733-138764755 ATCTGTTTAAAGTAGGAGGCAGG - Intronic
962833716 3:139167640-139167662 TTTTGTATAAAGTATAAGGAAGG + Intronic
962997442 3:140644784-140644806 TTGTGTATAAGGTATAAGGAAGG + Intergenic
963032484 3:140992485-140992507 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
963048114 3:141118661-141118683 TTTTGTATAAAGTGTAAGGAAGG + Intronic
963175647 3:142295038-142295060 TTTTGTATAAGGTATAAGGAAGG - Intergenic
963190583 3:142467315-142467337 TTGTGACTAAAGTAGGAACATGG - Intronic
963289875 3:143476791-143476813 TTGTCCACAAAGTAGGAGGGAGG + Intronic
963303610 3:143625585-143625607 TTTTGTATAAGGTATAAGGAAGG - Intronic
963341972 3:144047137-144047159 TTGAGTAAAAAGGAGGAGGGAGG - Intronic
963410907 3:144926580-144926602 TTTTGTATAAGGTATAAGGAAGG + Intergenic
963517014 3:146321810-146321832 TTTTGTATATAGTAAAAGGAAGG - Intergenic
963576829 3:147070878-147070900 TTTTGTATACAGTGTGAGGAAGG + Intergenic
963578629 3:147096143-147096165 TTTTGTATAAGGTATAAGGAAGG - Intergenic
963584865 3:147174246-147174268 TTGTTTATAATGGAGGAGAAAGG + Intergenic
963825113 3:149944980-149945002 TTTTGTATAAGGTATAAGGAAGG + Intronic
963927235 3:150963884-150963906 TTTTGTATAAGGTATAAGGAAGG - Intronic
964128807 3:153264978-153265000 TTTTGTATAAAGTTGAAGGAAGG - Intergenic
964136218 3:153347691-153347713 TTTTGTATAAGGTATAAGGAAGG + Intergenic
964162011 3:153656832-153656854 TTTTGTATAAGGTATAAGGAAGG - Intergenic
964262424 3:154854343-154854365 TTTTGTATAAGGTATAAGGAAGG + Intergenic
964318980 3:155473896-155473918 TTTTGTATAAAGTGTAAGGAAGG - Intronic
964668442 3:159199335-159199357 TTGTCTTTAAAGTTGGAGGAAGG + Intronic
964695824 3:159506637-159506659 TTTTGTATAAGGTATAAGGAAGG + Intronic
964841884 3:161003009-161003031 TTTTGTATAAAGTGTAAGGAAGG + Intronic
964844800 3:161033662-161033684 TTTTGTATAAGGTATAAGGAAGG - Intronic
964962621 3:162446658-162446680 TTCTGTATAAAGTGTAAGGAAGG + Intergenic
964966822 3:162504466-162504488 TTTTGTATAAAGTATAAGGAAGG - Intergenic
965004668 3:163004912-163004934 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
965060238 3:163775366-163775388 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
965156794 3:165070005-165070027 TTGAGGATAAAATAGGAGAAAGG - Intronic
965159196 3:165109727-165109749 TTTTGTATAAGGTATAAGGAAGG - Intergenic
965182940 3:165427726-165427748 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
965217487 3:165881896-165881918 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
965218931 3:165901515-165901537 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
965252736 3:166363613-166363635 TTTTGTATAAGGTATAAGGAAGG - Intergenic
965436482 3:168658688-168658710 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
965497825 3:169419578-169419600 TTGTGTATAAGGTGTAAGGAAGG - Intronic
965525886 3:169717757-169717779 TTTTGTATAAGGTATAAGGAAGG - Intergenic
965889859 3:173499225-173499247 TTTTGTATAAGGTATAAGGAAGG + Intronic
965974978 3:174610134-174610156 TTTTGTATAAAGTGTAAGGAAGG - Intronic
966108900 3:176372912-176372934 TTTTGTATAGAGTAAGAGGTGGG - Intergenic
966131097 3:176640817-176640839 TTTTGTATAAGGTATAAGGAAGG + Intergenic
966255575 3:177913347-177913369 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
966277009 3:178185569-178185591 TTTTGTATAAGGTATAAGGAAGG + Intergenic
966306872 3:178546106-178546128 TTATGTACAAAGGAGAAGGAAGG + Intronic
966644081 3:182223652-182223674 TTTTGTACATAGTAGAAGGAAGG + Intergenic
966673180 3:182552486-182552508 TTTTGTATAAGGTATAAGGAAGG + Intergenic
967144938 3:186598511-186598533 ATGTGTGTGAAGGAGGAGGAAGG - Intergenic
967375637 3:188797358-188797380 ATATGTTTAAAGTAGTAGGAAGG + Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967820938 3:193838119-193838141 TTTTGTATAAGGTATAAGGAAGG - Intergenic
968019322 3:195370412-195370434 TTTTGTATACAGTATAAGGAAGG + Intronic
968374806 4:30711-30733 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
968955594 4:3717266-3717288 TGCTGTATGAAGCAGGAGGAAGG + Intergenic
969151331 4:5171478-5171500 TTTTGTATAAGGTACAAGGAAGG + Intronic
969594118 4:8138682-8138704 TTTTGTATAAGGTATAAGGAAGG - Intronic
970014667 4:11500045-11500067 TTTTGTATAAGGTATAAGGAAGG + Intergenic
970020511 4:11562393-11562415 TTTTGTATAAGGTATAAGGAAGG - Intergenic
970144766 4:13023743-13023765 TTGTGTATGAAGTGCAAGGATGG - Intergenic
970633691 4:17982935-17982957 TTTTGTATAAGGTATAAGGAAGG + Intronic
970642873 4:18087088-18087110 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
970654937 4:18220486-18220508 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
970744926 4:19282910-19282932 TTTTGTATAAGGTTTGAGGAAGG - Intergenic
970769651 4:19595703-19595725 TTTTGTAAAAAGTAAGAAGAAGG + Intergenic
970775734 4:19671830-19671852 TTTTGTATAAGGTATAAGGAAGG - Intergenic
970862233 4:20717504-20717526 TTTTGTATAAAGTGTAAGGAAGG + Intronic
970864555 4:20743590-20743612 TTTTGTATAAAGTGTAAGGAAGG - Intronic
970975246 4:22036016-22036038 TTTTGTATAAGGTATAAGGAAGG + Intergenic
970997944 4:22289462-22289484 TTTTGTATAAGGTATAAGGAAGG + Intergenic
971096960 4:23417397-23417419 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
971247503 4:24943386-24943408 TTTTGTATAAGGTATAAGGAAGG - Intronic
971429096 4:26544996-26545018 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
971453729 4:26823890-26823912 TTCTGTATAAAGAAGGAAGAGGG - Intergenic
971489535 4:27196889-27196911 TTTTGTATAAGGTATGAGGAAGG - Intergenic
971517931 4:27512095-27512117 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
971668505 4:29525050-29525072 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
971721595 4:30252068-30252090 TTTTGTATAAGGTATAAGGAAGG + Intergenic
971737857 4:30480323-30480345 TTTTGTATATAGTAAGAGGTAGG + Intergenic
971970581 4:33614136-33614158 TTGTGTACATATTAAGAGGAAGG + Intergenic
972045970 4:34664576-34664598 TTGTGTCTGAATTTGGAGGAGGG + Intergenic
972252002 4:37311799-37311821 TTTTGTATAAGGTATAAGGAAGG + Intronic
972317378 4:37939693-37939715 TTTTGTATAAGGTATAAGGAAGG + Intronic
972372005 4:38433365-38433387 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
972376982 4:38481404-38481426 TTTTGTATAAGGTATAAGGAAGG - Intergenic
972500302 4:39671646-39671668 TTTTGTATAAGGTATAAGGAAGG + Intergenic
972677204 4:41271598-41271620 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
972681825 4:41313743-41313765 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
972691298 4:41401202-41401224 TTTTGTATAAAGTGTAAGGAAGG + Intronic
972763447 4:42129697-42129719 TTTTGTATAAGGTATAAGGAAGG - Intronic
972870199 4:43288644-43288666 TTTTGTATAAGGTATAAGGAAGG - Intergenic
972895312 4:43612824-43612846 TTTTGTATAAGGTATAAGGAAGG + Intergenic
972901890 4:43695570-43695592 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
972916910 4:43892676-43892698 TTTTGTATAAGGTATAAGGAAGG + Intergenic
972943665 4:44227210-44227232 TTTTGTATAAGGTATAAGGAAGG + Intronic
972947102 4:44269360-44269382 TTTTGTATAAGGTATAAGGAAGG - Intronic
972984923 4:44751598-44751620 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
973055815 4:45656142-45656164 TTTTGTATAAGGTATAAGGAAGG - Intergenic
973086171 4:46063507-46063529 TTTTGTATAAGGTATAAGGAAGG - Intronic
973133673 4:46678877-46678899 TTTTGTATAAAGTATAAGGAAGG - Intergenic
973273461 4:48284869-48284891 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
973276348 4:48313777-48313799 TTTTGTATAAGGTATAAGGAAGG + Intergenic
973313236 4:48731754-48731776 TTTTGTATAAGGTATAAGGAAGG - Intronic
973328417 4:48887508-48887530 TTTTGTATAAGGTATAAGGAAGG + Intronic
973682357 4:53333570-53333592 TTTTGTATAAGGTATAAGGAAGG - Intronic
973921934 4:55695766-55695788 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
973926167 4:55740078-55740100 CTTTGGATATAGTAGGAGGAGGG + Intergenic
973980281 4:56303039-56303061 ATGTGTATAAAGAAGGAGTCTGG + Intronic
974339142 4:60591403-60591425 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
974342462 4:60632151-60632173 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
974371014 4:61016600-61016622 TTTTGTATAAGGTATAAGGAAGG - Intergenic
974444106 4:61956707-61956729 TTGTGTATAAGGTATAAGGAAGG + Intronic
974596507 4:64019734-64019756 TTTTGTATAAGGTATAAGGAAGG + Intergenic
974804177 4:66858775-66858797 TTTTGTATAAGGTATAAGGAAGG - Intergenic
974837573 4:67269369-67269391 TTTTGTATACAGTGGAAGGAAGG + Intergenic
974937460 4:68425146-68425168 TTTTGTATAAAGTATAAGGAAGG - Intergenic
974938643 4:68437774-68437796 TTTTGTATAAAGTATAAGGAAGG + Intergenic
974968404 4:68794374-68794396 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
975001969 4:69235693-69235715 TTCTGTATAAGGTGTGAGGAAGG - Intergenic
975003465 4:69256399-69256421 TTCTGTATAAGGTGTGAGGAAGG + Intergenic
975010261 4:69341976-69341998 TTTTGTATAAAGTGTAAGGAAGG - Intronic
975055866 4:69928326-69928348 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
975083466 4:70308450-70308472 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
975088923 4:70377464-70377486 TTTTGTATAAAGTGTAAGGAAGG - Intronic
975304048 4:72827162-72827184 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
975322779 4:73027031-73027053 TTTTGTGTAAAGTGTGAGGAAGG - Intergenic
975479760 4:74864772-74864794 TTTTGTATAAAGTGCAAGGAAGG - Intergenic
975902522 4:79169576-79169598 TTTTGTATAAGGTATGAAGACGG - Intergenic
975965866 4:79971739-79971761 TTTTGTATAAAGTGTAAGGAAGG - Intronic
975993921 4:80291706-80291728 TTTTGTATAAAGTGTAAGGAAGG + Intronic
976031767 4:80763926-80763948 TTTTGTATAAGGTATAAGGAAGG - Intronic
976074360 4:81279908-81279930 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
976093965 4:81487907-81487929 TTTTGTATAAGGTATAAGGAAGG - Intronic
976120770 4:81778750-81778772 TTTTGTATAAGGTATAAGGAAGG + Intronic
976272541 4:83245765-83245787 TTTTGTATAAAGTGTGAGGAAGG - Intergenic
976376064 4:84346406-84346428 TTTTGTATAAGGTATAAGGAAGG - Intergenic
976450936 4:85190184-85190206 TTTTGTATAAGGTATAAGGAAGG + Intergenic
976452981 4:85213366-85213388 TTTTGTATAAGGTACAAGGAAGG + Intergenic
976580088 4:86725989-86726011 TTTTGTATAAGGTGGAAGGAAGG + Intronic
976709029 4:88049530-88049552 TTGTTTATAAAGAACAAGGAAGG + Intronic
976809460 4:89085280-89085302 TTTTGTATAAAGTCCAAGGAAGG + Intronic
977255020 4:94731139-94731161 TAGAGTATAAAGAAGGAGTATGG + Intergenic
977333700 4:95668675-95668697 TTTTGTATAAGGTATAAGGAAGG - Intergenic
977737601 4:100435848-100435870 TTTTGTATAAGGTATAAGGAAGG - Intronic
977857197 4:101908376-101908398 TTTTGTATAAGGTATAAGGAAGG - Intronic
977867430 4:102046263-102046285 TTTTGTATAAGGTATAAGGAAGG - Intronic
977888329 4:102277956-102277978 TTTTGTATAAAGTGTAAGGAAGG - Intronic
977931548 4:102755441-102755463 TTTTGTATAAGGTATAAGGAAGG - Intronic
977947163 4:102927070-102927092 TTTTGTATAAGGTATAAGGAAGG - Intronic
977998783 4:103530113-103530135 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
978049740 4:104183691-104183713 TTTTGTATAAAGTATAAGGAAGG - Intergenic
978064395 4:104378504-104378526 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
978181189 4:105798025-105798047 TTGTTGATAAAGTAGCAGCAGGG - Intronic
978197316 4:105986344-105986366 TTTTGTATAAAGTGTAAGGAAGG + Intronic
978231287 4:106403626-106403648 TTTTGTATAAGGTATAAGGAAGG + Intergenic
978251838 4:106640248-106640270 TTTTGTATAAGGTATAAGGAAGG - Intergenic
978275102 4:106939929-106939951 TTTTGTATAAGGTATAAGGAAGG - Intronic
978286490 4:107083799-107083821 TTTTGTATAAGGTATAAGGAAGG - Intronic
978471378 4:109071267-109071289 TTTTGTATAAGGTATAAGGAAGG - Intronic
978626220 4:110688626-110688648 TTTTGTATAAGGTATAAGGAAGG + Intergenic
978637704 4:110829369-110829391 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
978900069 4:113938359-113938381 TTTTGTATAAAGTGTAAGGAAGG - Intronic
978918225 4:114150606-114150628 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
978927221 4:114261766-114261788 TTTTGTATAAGGTATAAGGAAGG - Intergenic
978929356 4:114291984-114292006 TTTTGTATAAGGTATAAGGAAGG - Intergenic
978948129 4:114523721-114523743 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
978960459 4:114671646-114671668 TTTTGTATAAAGTGTAAGGAAGG - Intronic
978973354 4:114837647-114837669 TTTTGTATAAAGTGTAAGGAAGG - Intronic
979220625 4:118219511-118219533 TTTTGTATAAGGTATAAGGAAGG - Intronic
979609712 4:122676348-122676370 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
979758040 4:124366201-124366223 TTTTGTATAAGGTATAAGGAAGG - Intergenic
980436088 4:132776005-132776027 TTGTCTATAAACTAGGAAGATGG - Intergenic
980509544 4:133767336-133767358 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
980578426 4:134715610-134715632 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
980653286 4:135748997-135749019 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
980695738 4:136352987-136353009 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
980731753 4:136833037-136833059 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
980744243 4:136994678-136994700 TTTTGTATAAGGTATAAGGAAGG + Intergenic
981165674 4:141554262-141554284 TTTTGTATAAGGTATAAGGAAGG - Intergenic
981188947 4:141838593-141838615 TTATGTATAAAGTGTAAGGAAGG - Intergenic
981222965 4:142258173-142258195 TTTTGTATAAGGTATAAGGAAGG - Intronic
981254220 4:142642438-142642460 TTTTGTATAAGGTATAAGGAAGG + Intronic
981290250 4:143066797-143066819 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
981319188 4:143371720-143371742 TTTTGTATAAGGTGTGAGGAAGG + Intronic
981365356 4:143895977-143895999 TTTTGTATAAAGTGTAAGGAAGG - Intronic
981418933 4:144526738-144526760 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
981625751 4:146752872-146752894 TTTTGTATAAGGTATAAGGAAGG - Intronic
981750350 4:148087684-148087706 TTTTGTATAAGGTATAAGGAAGG - Intronic
981910699 4:149978465-149978487 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
982479876 4:155896215-155896237 TTTTGTATACAGTGTGAGGAAGG - Intronic
982686911 4:158501497-158501519 TTTTGTATAAAGTGTAAGGAAGG + Intronic
982744409 4:159091751-159091773 TTTTGTATAAGGTATAAGGAAGG - Intergenic
982810533 4:159820360-159820382 TTTTGTATAAGGTATAAGGAAGG - Intergenic
982815001 4:159873579-159873601 TTTTGTATAAGGTATAAGGAAGG + Intergenic
982826216 4:160006955-160006977 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
982839723 4:160168488-160168510 TTTTGTATGAAGTATAAGGAAGG + Intergenic
983148470 4:164246421-164246443 TTTTGTATAAGGTATAAGGAAGG - Intronic
983222331 4:165054931-165054953 TTGTGTATAGAGTTGGGGGTGGG + Intergenic
983429136 4:167625570-167625592 TTGTTTATATAGAATGAGGAGGG - Intergenic
983451160 4:167913201-167913223 TTTTGTATAAGGTATAAGGAAGG - Intergenic
983534253 4:168840423-168840445 TTGTGTATAAAGAAGGGCCAAGG - Intronic
983597584 4:169488342-169488364 TTTTGTATAAAGTTTAAGGAAGG + Intronic
983964283 4:173790864-173790886 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
984131452 4:175880057-175880079 TTTTGTATAAGGTACAAGGAAGG + Intronic
984306584 4:177999853-177999875 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
984308058 4:178019868-178019890 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
984751276 4:183278148-183278170 TTTTGTATAAGGTATAAGGAAGG + Intronic
985311100 4:188600394-188600416 TTGTGTCTTAGGTAGTAGGAAGG + Intergenic
985332904 4:188860120-188860142 TTTTGTATAAAGTTTAAGGAAGG + Intergenic
985366936 4:189241168-189241190 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
985389352 4:189479087-189479109 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
985460233 4:190098334-190098356 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
986090256 5:4497517-4497539 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
986126662 5:4888743-4888765 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
986380097 5:7175520-7175542 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
986490595 5:8285645-8285667 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
986527678 5:8698088-8698110 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
986804450 5:11295803-11295825 TTTTGTATAAAGTGTAAGGAAGG - Intronic
986856317 5:11872824-11872846 TTTTGTATAAGGTATAAGGAAGG - Intronic
986896718 5:12379925-12379947 TTTTGTATATAGTGTGAGGATGG + Intergenic
986902204 5:12450306-12450328 TTTTGTATAAGGTATAAGGAAGG - Intergenic
987064318 5:14273460-14273482 TTGTGTTTGAAGTCAGAGGACGG + Intronic
987278950 5:16392870-16392892 TTCTGCATAAAGGAGGATGAGGG + Intergenic
987464891 5:18260347-18260369 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
987897048 5:23960128-23960150 TTTTGTATAAAGTGTAAGGAAGG - Intronic
987957152 5:24754957-24754979 TTTTGTATAAGGTATAAGGAAGG - Intergenic
987992210 5:25227395-25227417 TTTTGTATAAGGTATAAGGAAGG + Intergenic
988036408 5:25832868-25832890 TTTTGTATAAGGTATAAGGAAGG - Intergenic
988186741 5:27873782-27873804 TTTTGTATAAGGTGGAAGGAAGG - Intergenic
988240975 5:28608792-28608814 TTGTGTATAGAGTAAGATAAGGG - Intergenic
988293102 5:29316417-29316439 TTTTGTATAAGGTGTGAGGACGG + Intergenic
988308622 5:29528016-29528038 TTTTGTATAAGGTATAAGGAGGG - Intergenic
988321553 5:29704470-29704492 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
988459395 5:31419165-31419187 TTGTGTTTCAAGAAGGAGGAGGG + Intronic
988549058 5:32184066-32184088 TTTTGTATATAGTATGAGGTAGG - Intergenic
988587117 5:32516962-32516984 TTTTGTATAAGGTATAAGGAAGG + Intergenic
988614579 5:32763002-32763024 TTTTGTATAAGGTATAAGGAAGG + Intronic
988704190 5:33707773-33707795 TTTTGTATAAAGTGTAAGGAAGG - Intronic
988975618 5:36512999-36513021 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
989029191 5:37100279-37100301 TTTTGTATAAGGTATAAGGAAGG + Intergenic
989072641 5:37527453-37527475 TTTTGTATAAGGTATAAGGAAGG - Intronic
989276362 5:39594411-39594433 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
989397319 5:40971757-40971779 TTTTGTATAAGGTATAAGGAAGG + Intronic
989629771 5:43469737-43469759 TTGAGAATAAAATAGGAGGCAGG - Intronic
989769076 5:45120838-45120860 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
989778698 5:45239019-45239041 TTCTGTATAAGGTATAAGGAAGG + Intergenic
989799225 5:45515715-45515737 TTGGGTATAAAGTAGCTGGATGG - Intronic
990103029 5:52216610-52216632 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
990111904 5:52336789-52336811 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
990359290 5:55001887-55001909 TTTTGTATAAGGTATAAGGAAGG - Intronic
990654936 5:57944521-57944543 TTTTGTATAAGGTATAAGGAAGG + Intergenic
990750904 5:59015093-59015115 TTTTGTATAAAGTGTAAGGAAGG - Intronic
990842338 5:60096381-60096403 TTATGTATAAGGTATAAGGAAGG - Intronic
991140092 5:63230486-63230508 TTTTGTATAAGGTATAAGGAAGG - Intergenic
991143860 5:63278300-63278322 TTTTGTATAAGGTATAAGGAAGG + Intergenic
991148375 5:63335111-63335133 TTTTGTATAAGGTATAAGGAAGG + Intergenic
991170280 5:63616364-63616386 TTTTGTATAAGGTATAAGGAAGG - Intergenic
991227323 5:64288072-64288094 TTTTGTATAAAGTGTAAGGAAGG + Intronic
991232422 5:64350579-64350601 TTTTGTATAAGGTATAAGGAAGG + Intronic
991397314 5:66218069-66218091 TTTTGTATAAGGTATAAGGAAGG + Intergenic
991421332 5:66445449-66445471 TTTTGTATAAGGTATAAGGAAGG + Intergenic
991504301 5:67308162-67308184 TTCTGTCAACAGTAGGAGGAAGG - Intergenic
991551098 5:67836560-67836582 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
991628069 5:68625401-68625423 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
991935815 5:71798932-71798954 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
992338045 5:75793788-75793810 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
992428185 5:76680304-76680326 TTTTGTATAGAGTGGAAGGAAGG - Intronic
992466400 5:77009922-77009944 TTCTGTAACAAGTAGGAAGATGG - Intergenic
992505510 5:77383651-77383673 TTTTGTATAAAGTGTAAGGAAGG + Intronic
992580540 5:78170904-78170926 TTTTGTATAAAGTGTAAGGAAGG + Intronic
992603978 5:78436394-78436416 TTTTGTATAAGGTATAAGGAAGG + Intronic
992740108 5:79765159-79765181 TTTTGTATAAGGTATAAGGAAGG + Intronic
992897878 5:81262161-81262183 TTTTGTATAAAGTGTAAGGAAGG - Intronic
993291556 5:86078689-86078711 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
993365129 5:87025870-87025892 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
993368054 5:87057201-87057223 TTTTGTATAAGGTATAAGGAAGG + Intergenic
993420267 5:87692871-87692893 TTTTGTATAAGGTATAAGGAAGG + Intergenic
993459787 5:88169199-88169221 TTTTGTATAAAGTTTAAGGAAGG + Intergenic
993476805 5:88376497-88376519 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
993487691 5:88506658-88506680 GTGTAAAGAAAGTAGGAGGAGGG - Intergenic
993655866 5:90577286-90577308 TTTTGTATAAGGTACAAGGAAGG + Intronic
993674416 5:90799898-90799920 TTTTGTATAAGGTATAAGGAAGG - Intronic
993827749 5:92713293-92713315 TTGCTAATAAATTAGGAGGAGGG + Intergenic
994224378 5:97235434-97235456 TTTTGTATAAGGTATAAGGAAGG + Intergenic
994229871 5:97300814-97300836 TTTTGTATAAGGTATAAGGAAGG + Intergenic
994309399 5:98250477-98250499 TTTTGTATATAGTAAGAGGTAGG - Intergenic
994315280 5:98325947-98325969 TTTTGTATAACGTATAAGGAAGG - Intergenic
994496050 5:100515440-100515462 TTTTGTATAAGGTATAAGGAAGG + Intergenic
994508400 5:100671836-100671858 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
994576749 5:101588278-101588300 TTTTGTATAAGGTATAAGGAAGG - Intergenic
994594051 5:101808095-101808117 TTTTGTATAAGGTATAAGGAAGG - Intergenic
994601554 5:101911775-101911797 TTTTGTATATAGTATAAGGAAGG + Intergenic
994888848 5:105602566-105602588 TTTTGTATAAGGTATAAGGAAGG - Intergenic
994917597 5:106000229-106000251 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
995112525 5:108443465-108443487 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
995113789 5:108456308-108456330 TTTTGTATAAGGTATAAGGAAGG + Intergenic
995117270 5:108495378-108495400 TTTTGTATAAGGTATAAGGAAGG - Intergenic
995162104 5:108994280-108994302 TTTTGTATAAGGTATAAGGAAGG + Intronic
995162881 5:109002443-109002465 TTTTGTATAAGGTATAAGGAAGG - Intronic
995463462 5:112426814-112426836 TTTTGTATAAGGTATAAGGAAGG + Intergenic
995586154 5:113650767-113650789 TTTTGTATAAGGTATAAGGAAGG - Intergenic
995605834 5:113854410-113854432 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
995671036 5:114603140-114603162 TTTTGTATAAAGTATAAGGAAGG - Intergenic
995693106 5:114849362-114849384 TTTTGTATAAGGTATAAGGACGG - Intergenic
995893781 5:116986851-116986873 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
996146747 5:119986323-119986345 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
996171822 5:120302926-120302948 TTTTGTATAAGGTATAAGGAAGG + Intergenic
996326152 5:122276525-122276547 TTTTGTATAAGGTATAAGGAAGG + Intergenic
996359677 5:122631968-122631990 TTTTGTATAAGGTATAAGGAAGG + Intergenic
996438103 5:123458327-123458349 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
996617586 5:125459304-125459326 TTTTGTATAAGGTATAAGGAAGG + Intergenic
996666989 5:126071452-126071474 TTTTGAATAAAGTGTGAGGAAGG + Intergenic
996673712 5:126150972-126150994 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
996687916 5:126304585-126304607 TTTTGTATAAGGTATAAGGAAGG - Intergenic
996952816 5:129148345-129148367 TTTTGTATAAGGTATAAGGAAGG + Intergenic
997004036 5:129797864-129797886 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
997068708 5:130593448-130593470 TTTTGTATAAGGTATAAGGAAGG - Intergenic
997808394 5:136942601-136942623 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
998211235 5:140200291-140200313 TTTTGTATAAGGTATAAGGAAGG + Intronic
998427642 5:142042600-142042622 TTTTGTATAAAGTATAAGGAAGG + Intergenic
998626940 5:143857024-143857046 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
998719918 5:144933218-144933240 TTTTGTATAAGGTATAAGGAAGG - Intergenic
998732636 5:145097811-145097833 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
998780925 5:145655720-145655742 TTTTGTATAAGGTGTGAGGAAGG - Intronic
998802291 5:145881990-145882012 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
998803629 5:145896102-145896124 TTTTGTATAAGGTATAAGGAAGG - Intergenic
999064316 5:148669368-148669390 TTTTGTATAAGGTATAAGGAAGG + Intronic
999067686 5:148708522-148708544 TTTTGTATATGGTAGGAGGTAGG - Intergenic
999489384 5:152034475-152034497 TTTTGTATAAGGTATAAGGAAGG + Intergenic
999564986 5:152848938-152848960 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
999603030 5:153287902-153287924 TTTTGTATAAGGTATAAGGAAGG - Intergenic
999607748 5:153334595-153334617 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
999985518 5:157001129-157001151 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1000283270 5:159801068-159801090 TTGTGGATAATGTAGCATGATGG + Intergenic
1000531503 5:162427158-162427180 TGGTGGATTAAGTAGGAGGTGGG - Intergenic
1000534488 5:162463070-162463092 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1000537815 5:162501017-162501039 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1000693634 5:164352797-164352819 GTGTGAATAAATTAGGGGGATGG - Intergenic
1000704534 5:164494246-164494268 TTGTGCATAGAGAAGAAGGAAGG + Intergenic
1000720295 5:164697716-164697738 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1000736947 5:164915413-164915435 TTGGGCAGAGAGTAGGAGGAAGG + Intergenic
1000837163 5:166169795-166169817 TTGTATATATGGTAGGAGGGAGG - Intergenic
1001124392 5:169006457-169006479 TTGTGTGTAATGTGGGAGGCTGG - Intronic
1002011539 5:176286457-176286479 TTTTGTATAAGGTATAAGGAAGG - Intronic
1002686308 5:181013472-181013494 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1002747019 6:66549-66571 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1002825776 6:772723-772745 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1002834162 6:851561-851583 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1002880730 6:1249986-1250008 TTTTGTATATAGTATAAGGAAGG + Intergenic
1003431127 6:6038674-6038696 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1003976390 6:11348744-11348766 TTTTGTATATAGTATAAGGAAGG - Intronic
1004028443 6:11842163-11842185 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1004304109 6:14484944-14484966 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1004730628 6:18354954-18354976 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1004860558 6:19800788-19800810 TTGAGTATAGAGTGGGAGGAGGG + Intergenic
1004949313 6:20650724-20650746 TTTTGTATAAGGTATAAGGAAGG + Intronic
1005151889 6:22761188-22761210 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1005240299 6:23817650-23817672 TTTTGTATAAGGTGGAAGGAAGG + Intergenic
1005267413 6:24126431-24126453 TTATGCATGAAGAAGGAGGAAGG - Intronic
1005791786 6:29310283-29310305 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1005936432 6:30525788-30525810 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1006041083 6:31255648-31255670 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1006183557 6:32167974-32167996 TTCTGTATAAATTAGGGGGCAGG - Exonic
1006762879 6:36478888-36478910 TTGTGTACAAAGAAGAATGAAGG - Intronic
1006999251 6:38293638-38293660 TTTTGTATAAAGTGTAAGGAAGG - Intronic
1007987937 6:46225956-46225978 TTGTGTATAAAGTAGGAGGAAGG + Intronic
1008116566 6:47557496-47557518 TTTTGTATAAGGTATAAGGAAGG + Intronic
1008138368 6:47803105-47803127 CTGTGGATAAAATAGAAGGAAGG + Intronic
1008269679 6:49476393-49476415 TTTTGTATAAGGTATAAGGAAGG - Intronic
1008386250 6:50894386-50894408 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1008548910 6:52608722-52608744 TTTTGTATAAAGTATCAGGAAGG + Intergenic
1008557215 6:52685073-52685095 TTGTGTATAAAAAAACAGGAAGG + Intronic
1008642739 6:53481397-53481419 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1008707192 6:54177022-54177044 TTTTGTATAAGGTGTGAGGAAGG - Intronic
1008782095 6:55119941-55119963 TTTTGTATAAGGTATAAGGAAGG + Intronic
1008915326 6:56780897-56780919 TTTTGTATAAGGTATAAGGAAGG + Intronic
1008965956 6:57312862-57312884 TTTTTTATATAGTAGGAGGTAGG + Intergenic
1008992353 6:57618316-57618338 TTGTGTATAAAGAGGGATCATGG + Intronic
1009037133 6:58131147-58131169 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1009160387 6:60275421-60275443 TTTTGTATATAGTATAAGGAAGG + Intergenic
1009180976 6:60517428-60517450 TTGTGTATAAAGAGGGATCATGG + Intergenic
1009212933 6:60884755-60884777 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1009264562 6:61536728-61536750 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1009336511 6:62496987-62497009 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1009361186 6:62816841-62816863 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1009362372 6:62830199-62830221 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1009380963 6:63029226-63029248 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1009422039 6:63474305-63474327 TTGTGTAGAAAGTGGGAAAACGG + Intergenic
1009504064 6:64452829-64452851 TTTTGTATAAGGTATAAGGAAGG - Intronic
1009524866 6:64731099-64731121 TTTTGTATAAGGTATAAGGAAGG - Intronic
1009592628 6:65691752-65691774 TTTTGTATAAAGTGTAAGGATGG + Intronic
1009727423 6:67553522-67553544 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1009741047 6:67746707-67746729 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1009805874 6:68601562-68601584 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1009982779 6:70745344-70745366 TTTTGTATAAGGTATAAGGAAGG + Intronic
1010006689 6:71002967-71002989 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1010119275 6:72354860-72354882 TTATGTATAAAGTAGCAACAGGG - Intronic
1010412318 6:75574559-75574581 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1010556080 6:77281434-77281456 TTTTGTATATGGTATGAGGAAGG - Intergenic
1010675806 6:78741537-78741559 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1010683212 6:78820679-78820701 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1010834394 6:80569089-80569111 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1010836808 6:80598389-80598411 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1011017804 6:82777797-82777819 GTGTGTATAAAGTAGGGGTTGGG + Intergenic
1011171165 6:84505688-84505710 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1011177903 6:84585730-84585752 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1011235032 6:85206961-85206983 TTTTGTATAAAGTATAAGGAAGG - Intergenic
1011302384 6:85890082-85890104 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1011407834 6:87034402-87034424 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1011523887 6:88241645-88241667 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1011761164 6:90567033-90567055 TTTTGTATAAGGTATAAGGAAGG - Intronic
1011932356 6:92730086-92730108 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1011971117 6:93224187-93224209 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1012063504 6:94516527-94516549 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1012184206 6:96193023-96193045 TTTTGTATAAAGTGTAAGGAAGG - Intronic
1012343058 6:98152627-98152649 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1012361716 6:98390543-98390565 TTTTGTATAAGGTGGAAGGAAGG + Intergenic
1012507951 6:99970732-99970754 TTTTGTATAAAGTGTAAGGAAGG + Intronic
1012513500 6:100031567-100031589 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1012613544 6:101247145-101247167 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1012644186 6:101659183-101659205 TTTTGTATAAAGAATAAGGAAGG + Intronic
1012740739 6:103013688-103013710 TTTTTTATAAAGTATAAGGAAGG + Intergenic
1012778672 6:103529006-103529028 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1012836531 6:104276473-104276495 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1012871332 6:104676031-104676053 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1012878867 6:104761518-104761540 TTTTGTATAAAGTATAAGGAAGG - Intronic
1012933684 6:105343347-105343369 TTTTGTATAAGGTATAAGGAAGG - Intronic
1013123998 6:107165335-107165357 TTTTGTATAAAGTGTGAGGAAGG + Intronic
1013319783 6:108976175-108976197 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1013390762 6:109684218-109684240 TTTTGTATCAAGTATAAGGAAGG - Intronic
1013844567 6:114434306-114434328 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1013902992 6:115180041-115180063 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1014193994 6:118531331-118531353 TTTTGTATATAGTATAAGGAAGG - Intronic
1014409512 6:121097017-121097039 TTTTGTATAAAGTATAAGGAAGG - Intronic
1014423389 6:121272077-121272099 TTTTGTATAAGGTGTGAGGAAGG - Intronic
1014560189 6:122880471-122880493 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1014674152 6:124344002-124344024 TTTTGTATAAGGTATAAGGAAGG + Intronic
1014784970 6:125608471-125608493 TTTTGTATAAAGTATAAGGAAGG + Intergenic
1014785105 6:125609920-125609942 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1014825388 6:126044225-126044247 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1014890465 6:126837974-126837996 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1014938116 6:127407780-127407802 TTTTGTATAAAGTATGAGGAAGG + Intergenic
1014967276 6:127770790-127770812 TTTTGTATAAGGTATAAGGAAGG + Intronic
1015056810 6:128912346-128912368 TTGTGTAAAAAGAGGGAGAAAGG - Intronic
1015247516 6:131091288-131091310 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1015282100 6:131444706-131444728 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1015358626 6:132309823-132309845 TTGTGTATAAGGTGTAAGGAAGG - Intronic
1015651743 6:135469786-135469808 TTTTGTATAAGGTATAAGGAAGG - Intronic
1015659686 6:135561416-135561438 TTTTGTATAATGTATGAGGAAGG + Intergenic
1015707091 6:136099944-136099966 TTTTGTATAAGGTATAAGGAAGG + Intronic
1015719263 6:136224313-136224335 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1016111925 6:140235062-140235084 TTTTGTATAAGGTATAAGGAGGG - Intergenic
1016232262 6:141819651-141819673 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1016588679 6:145718439-145718461 TTTTGTATAAAGTGTAAGGAAGG - Intronic
1016593811 6:145775980-145776002 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1016638642 6:146323762-146323784 TTTTGTATAAAGTGTAAGGAAGG + Intronic
1016642355 6:146363650-146363672 TTCTGTATAAAGCAACAGGAAGG - Intronic
1016991031 6:149928413-149928435 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1017203413 6:151779263-151779285 TTTTGTATAAGGTATAAGGAAGG + Intronic
1017310238 6:152967528-152967550 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1017368214 6:153670159-153670181 TTGTGGGCAAAATAGGAGGAAGG + Intergenic
1017375549 6:153763506-153763528 TTTTGTATAAAGTGAGAGGTGGG - Intergenic
1017377193 6:153785033-153785055 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1017720450 6:157240029-157240051 TTATGTATAAAATATTAGGACGG - Intergenic
1018062189 6:160098994-160099016 ATTTTTGTAAAGTAGGAGGAAGG - Intronic
1018113629 6:160561237-160561259 TTGTGTATAAGGTGTAAGGAAGG + Intronic
1018339809 6:162839764-162839786 TTTTGTATAAGGTATAAGGAAGG + Intronic
1018658153 6:166060178-166060200 TTTTGTATAAGGTATGAGAAAGG + Intergenic
1019203161 6:170336218-170336240 TTTTGTATAAGGTATAAGGAAGG + Intronic
1020366786 7:7389168-7389190 TTTTGTATAAAGTGTAAGGAAGG + Intronic
1020443527 7:8244378-8244400 TTTTGTATAAAGTGTAAGGAAGG - Intronic
1020568445 7:9826038-9826060 TTTTGTATAAAGTATAAGGAAGG + Intergenic
1020622243 7:10532619-10532641 TTTTGTATAAGGTATGAGGAAGG - Intergenic
1020630241 7:10630636-10630658 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1020642804 7:10777704-10777726 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1020751156 7:12143912-12143934 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1021011550 7:15474517-15474539 TTTTGTATAAAGTTTAAGGAAGG - Intronic
1021051508 7:15990985-15991007 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1021060242 7:16102277-16102299 TTTTGTATAAGGTATAAGGAAGG - Intronic
1021235335 7:18136474-18136496 TTTTGTATAAGGTGGAAGGAAGG + Intronic
1021243045 7:18228710-18228732 TTATGTTTTCAGTAGGAGGAAGG + Intronic
1021435138 7:20605287-20605309 TTTTGTATAAGGTAGAAGGAAGG - Intergenic
1021486934 7:21177814-21177836 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1021492378 7:21233201-21233223 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1021671007 7:23034904-23034926 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1021733584 7:23620749-23620771 TTTTGTATAAAGTGTAAGGAAGG + Intronic
1021967627 7:25936880-25936902 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1022188145 7:27989259-27989281 TTTTGTATAAGGTATAAGGAAGG - Intronic
1022270976 7:28807810-28807832 TTGAGAATGAAGAAGGAGGAAGG + Intronic
1022422383 7:30236053-30236075 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1022435656 7:30381846-30381868 TTTTGTATAAGGTATAAGGAAGG + Intronic
1022594689 7:31701530-31701552 TAGTTTATAAAGTAGCAGCAGGG + Intronic
1022608766 7:31846450-31846472 TTTTGTATAAGGTATAAGGAAGG - Intronic
1022686281 7:32600247-32600269 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1022994460 7:35740370-35740392 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1022997004 7:35767063-35767085 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1023035139 7:36124922-36124944 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1023051399 7:36255308-36255330 TTTTGTATAAAGTGCAAGGAAGG + Intronic
1023413149 7:39908092-39908114 TTGTGTATAGGGTGGGAGGTGGG - Intergenic
1023812676 7:43924544-43924566 ATGTCAATAATGTAGGAGGATGG + Intronic
1024033931 7:45490639-45490661 TTTTGTATAAGGTAGAAGGAAGG + Intergenic
1024317756 7:48036769-48036791 TGGGGTCTAAAGTAGGAGCAAGG - Intronic
1024416612 7:49115138-49115160 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1024456134 7:49609383-49609405 TTTTGTATATAGTGTGAGGAAGG + Intergenic
1024950005 7:54850856-54850878 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1024990079 7:55226958-55226980 TTTTGTACAAGGTATGAGGAAGG + Intronic
1025121702 7:56309726-56309748 TTGTGTATAAAGTGTAAGGAAGG + Intergenic
1025183693 7:56839580-56839602 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1025287337 7:57675413-57675435 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1025688232 7:63737407-63737429 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
1025720586 7:64008414-64008436 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1025843628 7:65175591-65175613 TTTTGTATAAAGTATAAGGAAGG + Intergenic
1025894023 7:65682213-65682235 TTTTGTATAAAGTATAAGGAAGG + Intergenic
1025945868 7:66104057-66104079 TAGTTGATAAAGTAGGAGCAGGG - Intronic
1026388003 7:69870729-69870751 TTGTATAGAAAGTAGGACAAAGG + Intronic
1026429721 7:70332784-70332806 TTTTGTATAAAGTATAAGGAAGG - Intronic
1026488601 7:70843128-70843150 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1027522777 7:79230963-79230985 TTTTGTATAAAGTGTAAGGAAGG + Intronic
1027608324 7:80328093-80328115 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1028056824 7:86255598-86255620 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1028073792 7:86485194-86485216 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1028077984 7:86538087-86538109 TTTTGTATATAGTATAAGGAAGG - Intergenic
1028081738 7:86585830-86585852 TTGTATATAAGGTATAAGGAAGG + Intergenic
1028098878 7:86796233-86796255 TTTTGTATAAGGTACAAGGAAGG + Intronic
1028139612 7:87258997-87259019 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1028152364 7:87388596-87388618 TTTTGTATAAGGTATAAGGAAGG - Intronic
1028169164 7:87575022-87575044 TTGTATACAAAGTAGGAGAATGG - Intronic
1028181132 7:87726262-87726284 TTGTGTATAAGGTGTAAGGAAGG + Intronic
1028236726 7:88371959-88371981 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1028255097 7:88585623-88585645 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1028257996 7:88624684-88624706 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1028457806 7:91057576-91057598 TTTTGTATAAGGTATAAGGAAGG + Intronic
1028518661 7:91705234-91705256 TTTTGTATAAAGTGTAAGGAAGG - Intronic
1028524090 7:91764008-91764030 TTTTGTATAAGGTATAAGGAAGG - Intronic
1028616738 7:92777073-92777095 TTTTGTATAAGGTATAAGGAAGG + Intronic
1028629607 7:92920381-92920403 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1028633338 7:92960222-92960244 TTTTGTATAAGGTGGAAGGAAGG - Intergenic
1028785292 7:94785759-94785781 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
1028815774 7:95142522-95142544 TTTTGTATAAGGTGTGAGGAAGG + Intronic
1028821433 7:95216143-95216165 TTTTGTATAAGGTATAAGGAAGG + Intronic
1028836864 7:95384174-95384196 TTTTGTATAAGGTGTGAGGAAGG - Intronic
1028837194 7:95387953-95387975 TTTTGTATAAGGTGTGAGGAAGG - Intronic
1029256337 7:99272231-99272253 ATGTGAATCAAGTAAGAGGAAGG - Intergenic
1029785458 7:102785650-102785672 TTTTGTATAAGGTATAAGGAAGG - Intronic
1029883863 7:103846397-103846419 TTTTGTATAAAGTGTAAGGAAGG - Intronic
1029964086 7:104720361-104720383 TTTTGTATAAGGTATAAGGAAGG - Intronic
1030132530 7:106214883-106214905 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1030179744 7:106693533-106693555 AGGTGAACAAAGTAGGAGGAAGG - Intergenic
1030398386 7:109017155-109017177 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1030477811 7:110059899-110059921 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1030573050 7:111250724-111250746 TTTTGTATAAGGTATAAGGAAGG - Intronic
1030759816 7:113336659-113336681 TTTTGTATAAGGTAAAAGGAAGG - Intergenic
1030812153 7:113987732-113987754 CTGAGTATAATGTAAGAGGATGG + Intronic
1030833723 7:114257265-114257287 TTTTGTATAAGGTATAAGGAAGG - Intronic
1030922481 7:115408974-115408996 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1030980052 7:116175658-116175680 TTTTGTATAATGTATAAGGAAGG + Intergenic
1031103898 7:117515321-117515343 TTTTGTATAAGGTATAAGGAAGG + Intronic
1031171192 7:118293980-118294002 TTGCCTAGAAAGTAAGAGGAAGG - Intergenic
1031267454 7:119599358-119599380 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1031366428 7:120905668-120905690 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1031379517 7:121068285-121068307 TTTTGTATAAGGTATAAGGAAGG + Intronic
1031530875 7:122874852-122874874 TTTTGTATAAGGTATAAGGAAGG - Intronic
1031612105 7:123840157-123840179 TTTTGTATAAGGTATAAGGAAGG + Intronic
1031623495 7:123965472-123965494 TTTTGTATAAAGTATAAGGAAGG + Intronic
1031664113 7:124463896-124463918 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1031666887 7:124495675-124495697 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1031760726 7:125710225-125710247 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1031818603 7:126471361-126471383 TTGTGTATAAGGTGTAAGGAAGG + Intronic
1031827658 7:126586651-126586673 TTTTGTATAAGGTATAAGGAAGG - Intronic
1031864834 7:127027005-127027027 TTTTGTATAAGGTATAAGGAAGG + Intronic
1031899978 7:127397992-127398014 TTGTGTATAAGGTGTAAGGAAGG + Intronic
1031905479 7:127455910-127455932 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
1031908698 7:127490210-127490232 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1032417915 7:131752345-131752367 TTTTGTGAAAAGTAGAAGGAAGG + Intergenic
1032451166 7:132032594-132032616 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1032967667 7:137119631-137119653 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1032969134 7:137138585-137138607 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1032981069 7:137283852-137283874 ATGTGTATGAGGGAGGAGGATGG - Intronic
1033240824 7:139678347-139678369 TTTTGTATAAGGTATAAGGAAGG + Intronic
1033949902 7:146772355-146772377 TTGTTTTTAAAGGAAGAGGAGGG + Intronic
1033962682 7:146933408-146933430 TTTTGTATAAGGTATAAGGAAGG - Intronic
1033964040 7:146951465-146951487 TTTTGTATAAGGTGTGAGGAAGG + Intronic
1034109043 7:148518542-148518564 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1034310342 7:150082317-150082339 TGGTGTAAAAAGCAGGAGAAAGG - Intergenic
1034361278 7:150501065-150501087 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1034365931 7:150547610-150547632 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1034688203 7:152992523-152992545 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1034719033 7:153271101-153271123 TTTTGTATAAGGTACAAGGAAGG - Intergenic
1034722472 7:153307157-153307179 TTTTGTATAAGGTACAAGGAAGG - Intergenic
1034743498 7:153500548-153500570 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1034796503 7:154018336-154018358 TGGTGTAAAAAGCAGGAGAAAGG + Intronic
1034856701 7:154556199-154556221 TTGTGTATCAATTATGAGGTAGG + Intronic
1035135533 7:156699375-156699397 TTTTGTATAAAGTGTAAGGAAGG - Intronic
1035144724 7:156802971-156802993 TTTTGTATAAAGTGTAAGGAAGG - Intronic
1035711716 8:1721909-1721931 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1035840001 8:2801063-2801085 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1035894261 8:3379718-3379740 TTTTGTATAAAGTGTAAGGAAGG - Intronic
1036002759 8:4626384-4626406 TTGGTTATAAAGTATGTGGAAGG + Intronic
1036275203 8:7345217-7345239 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1036346159 8:7965132-7965154 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1036841477 8:12125888-12125910 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1036863291 8:12372137-12372159 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1037207137 8:16336799-16336821 TTTTGTATAAGGTGTGAGGACGG + Intronic
1037213406 8:16419729-16419751 TTTTGTATAAGGTACAAGGAAGG - Intronic
1037257826 8:16975027-16975049 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1037422142 8:18714101-18714123 TTTTGTATAAGGTATAAGGAAGG - Intronic
1037556366 8:20027632-20027654 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1037626601 8:20612987-20613009 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1038232931 8:25721689-25721711 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1038807558 8:30809361-30809383 TTATGTATCAACAAGGAGGATGG + Intronic
1038859032 8:31365536-31365558 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1038872877 8:31515304-31515326 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1038929409 8:32176298-32176320 TTTTGTATAAGGTATAAGGAAGG - Intronic
1039005360 8:33030558-33030580 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1039019540 8:33189817-33189839 TTTTGTATAAAGTGTGAGGAAGG - Intergenic
1039207409 8:35172650-35172672 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1039357134 8:36831931-36831953 TTTTGTATAATGTGTGAGGAAGG + Intronic
1039780670 8:40781913-40781935 TTCTGTATATGGTAGGAGGTAGG - Intronic
1039905488 8:41783259-41783281 TTGTGGATAATTTGGGAGGAGGG - Intronic
1040084736 8:43327837-43327859 TTTTGTATAAAGTCTAAGGAAGG + Intergenic
1040094259 8:43428679-43428701 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1040321513 8:46310476-46310498 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1040364416 8:46700436-46700458 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1040428419 8:47312892-47312914 TTGTGTATAAGGTGTAAGGAAGG + Intronic
1040458734 8:47626208-47626230 TTGTGTATAAGGTGTAAGGAAGG - Intronic
1040521854 8:48183865-48183887 TTTTGTATAATGTATAAGGAAGG - Intergenic
1040541112 8:48356698-48356720 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1040612889 8:49003138-49003160 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1040726786 8:50390254-50390276 TTTTGTATAAGGTATAAGGAAGG + Intronic
1040766459 8:50917097-50917119 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1041041398 8:53849881-53849903 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1041129534 8:54682969-54682991 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1041274006 8:56139089-56139111 TTTTGTATAAGGTATAAGGAGGG + Intergenic
1041293840 8:56333930-56333952 TTCTGTATAAGGTGGAAGGAAGG + Intergenic
1041341409 8:56850060-56850082 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1041425326 8:57714218-57714240 TTTTGTATAAAGTATAAGGAAGG - Intergenic
1041645586 8:60248422-60248444 TTTTGTATAAAGTGCAAGGAAGG + Intronic
1041844939 8:62317446-62317468 TTTTGTATAAGGTGTGAGGAAGG + Intronic
1041867279 8:62590145-62590167 TTGTGTTTAAAGTAGGAAAAGGG + Intronic
1041944461 8:63425726-63425748 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1042173087 8:66011187-66011209 TTTTGTATATAGTATAAGGAAGG - Intergenic
1042346823 8:67736088-67736110 TTCTCTGTAAAGTAGGAGGTGGG - Intronic
1042423009 8:68614460-68614482 TTTTGTATAAGGTATAAGGAAGG + Intronic
1042600006 8:70490055-70490077 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1042647365 8:71002264-71002286 TAGTCTATAAACTACGAGGAAGG + Intergenic
1042980484 8:74521299-74521321 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1043081240 8:75767735-75767757 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1043089271 8:75876877-75876899 TTTTGTATAAAGTATAAGGAAGG + Intergenic
1043182909 8:77107664-77107686 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1043194583 8:77275876-77275898 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1043235039 8:77853992-77854014 TTTTGTAAAAAGTATAAGGAAGG + Intergenic
1043309115 8:78836222-78836244 TTTTGTATAAAGTATAAGGAAGG - Intergenic
1043619367 8:82169772-82169794 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1043704036 8:83326657-83326679 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1043831803 8:84998230-84998252 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1044041238 8:87370898-87370920 TTTTGTATAAGGTATAAGGAAGG + Intronic
1044127754 8:88479175-88479197 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1044159406 8:88894587-88894609 TAATGTATAGAGTGGGAGGAGGG + Intergenic
1044222295 8:89683322-89683344 TTTTGTATAAAGTATAAAGAAGG - Intergenic
1044222684 8:89687772-89687794 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1044292329 8:90487174-90487196 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1044410246 8:91874341-91874363 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1044486886 8:92765029-92765051 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1044508135 8:93044696-93044718 TTTTGTATAAGGTATGAGGAAGG + Intergenic
1044594720 8:93947794-93947816 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1045091056 8:98743555-98743577 TTTTGTATAAAGTGTAAGGAAGG - Intronic
1045609855 8:103826395-103826417 TTGTGTATATAGTGTGAGGTAGG + Intronic
1045867495 8:106884701-106884723 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1045978254 8:108154022-108154044 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1046083641 8:109403938-109403960 TTGGGTACACAGTAGGATGAGGG + Intronic
1046298744 8:112258101-112258123 TTTTGTATAAGGTATAAGGAAGG - Intronic
1046434329 8:114167572-114167594 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1046572217 8:115980597-115980619 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1046667678 8:117022697-117022719 TTTTGTATAAAGTGTAAGGAAGG - Intronic
1046813066 8:118553502-118553524 TTTTGTATAAGGTGTGAGGAAGG - Intronic
1046828559 8:118718886-118718908 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1046840846 8:118855315-118855337 TTTTGTATAAAGTATAAGGAAGG + Intergenic
1047129757 8:122006047-122006069 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1047152356 8:122278290-122278312 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1047164715 8:122424676-122424698 TTTTGTATATAGTATAAGGAAGG + Intergenic
1047604569 8:126462228-126462250 TTTTGTATAACGTGTGAGGAAGG - Intergenic
1047674270 8:127183190-127183212 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1047744525 8:127834390-127834412 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1047877318 8:129153295-129153317 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1048129818 8:131682935-131682957 TTGTGTATAGTGTAAGAGAAAGG + Intergenic
1048913599 8:139160637-139160659 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1048951530 8:139500876-139500898 TTGTGAATGGAGGAGGAGGAAGG + Intergenic
1049088851 8:140498640-140498662 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1050037431 9:1451950-1451972 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1050118238 9:2282313-2282335 TTTTCTACAAAGTTGGAGGAAGG + Intergenic
1050241474 9:3640633-3640655 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1050442379 9:5679015-5679037 TTTTGTATAAGGTATAAGGAAGG + Intronic
1050492845 9:6207497-6207519 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1050680351 9:8103902-8103924 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1050751054 9:8937702-8937724 TTTTGTAAGAAGGAGGAGGAAGG - Intronic
1050806912 9:9692297-9692319 TGGTGTATAAAGCAAGAGGTAGG + Intronic
1050817017 9:9827477-9827499 TTTTGTATAAAGTGTAAGGAAGG - Intronic
1050864896 9:10486351-10486373 TTTTGTATAAGGTATAAGGAAGG + Intronic
1050870926 9:10568742-10568764 TTTTGTATAAAGTGTAAGGAAGG - Intronic
1050942382 9:11475993-11476015 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1050954264 9:11635118-11635140 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1050997422 9:12238000-12238022 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1051011262 9:12417074-12417096 ATGTATATAAAGTAGGAGACTGG - Intergenic
1051125364 9:13797488-13797510 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1051196870 9:14571695-14571717 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1051298248 9:15619124-15619146 TTGTGTCTCAAGGAGTAGGAAGG - Intronic
1051381802 9:16466651-16466673 TTTTGTATAAGGTATAAGGAAGG - Intronic
1051438347 9:17056302-17056324 TTTTGTATAAAGTTTAAGGAAGG + Intergenic
1051492804 9:17685618-17685640 TTTTGTATAAGGTGTGAGGAAGG + Intronic
1051578500 9:18645559-18645581 TTTTGTATAAGGTGTGAGGAAGG + Intronic
1051611184 9:18962969-18962991 TTTTGTATAAAGTGTAAGGAAGG + Intronic
1051695365 9:19762479-19762501 TTTTGTATAAAGTGTAAGGAAGG + Intronic
1051790515 9:20796986-20797008 TTTTGTATAAGGTATAAGGAAGG + Intronic
1051832733 9:21298438-21298460 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1051956522 9:22701757-22701779 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1052158883 9:25230172-25230194 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1052327456 9:27230902-27230924 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1052408391 9:28091521-28091543 TTTTGTATAAGGTATAAGGAAGG - Intronic
1052416276 9:28182284-28182306 TTTTGTATAAAGTGTAAGGAAGG - Intronic
1052534374 9:29728542-29728564 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1052598477 9:30593850-30593872 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1052604335 9:30679979-30680001 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1052627805 9:31000105-31000127 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1052645178 9:31225685-31225707 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1053727946 9:41023356-41023378 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1053751330 9:41259280-41259302 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1054256852 9:62823609-62823631 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1054284590 9:63156256-63156278 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1054318786 9:63631138-63631160 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
1054334454 9:63792004-63792026 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
1054334773 9:63796340-63796362 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
1054390226 9:64608698-64608720 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
1054889809 9:70238967-70238989 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1054985730 9:71260051-71260073 TTTTGTATAAAGTGTAAGGAAGG + Intronic
1055674865 9:78647718-78647740 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1055823508 9:80296804-80296826 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1056001410 9:82220897-82220919 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1056015398 9:82380824-82380846 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1056332454 9:85532421-85532443 TTGTGTAGCAGGTAGTAGGAAGG - Intergenic
1056422892 9:86446874-86446896 GTGTGTATGAAGGAGAAGGATGG + Intergenic
1056465522 9:86849923-86849945 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1056493588 9:87133170-87133192 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1056512831 9:87321875-87321897 TGGTCTATGGAGTAGGAGGAAGG - Intergenic
1056891333 9:90496050-90496072 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1058243400 9:102596037-102596059 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1058258021 9:102793470-102793492 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1059265880 9:113030062-113030084 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1059825069 9:118018842-118018864 TTTTGTACAAGGTATGAGGAAGG + Intergenic
1059962792 9:119582746-119582768 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1060396137 9:123318307-123318329 TTGTGTACAAAGCAGGCAGAGGG - Intergenic
1061875063 9:133539523-133539545 TTGTGTCTAGAGTAGGCGGAGGG + Intronic
1062705373 9:137936650-137936672 TTTTGTATAAGGTGTGAGGAAGG + Intronic
1203356487 Un_KI270442v1:153491-153513 TTTTGTATAAAGCATAAGGAAGG - Intergenic
1203574416 Un_KI270744v1:163440-163462 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1185806674 X:3064274-3064296 TTTTGTATAAAGTGTAAGGAAGG - Intronic
1185931510 X:4208419-4208441 TTCTGCATAATGTATGAGGAAGG + Intergenic
1185987116 X:4847375-4847397 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1186278557 X:7967271-7967293 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1186581329 X:10822311-10822333 TTTTGTATAAGGTATAAGGAAGG - Intronic
1186634688 X:11390097-11390119 TTTTGTATAAGGTATAAGGAAGG + Intronic
1186765749 X:12769072-12769094 TGGTTTATAAAGTAGGGGGTAGG + Intergenic
1186919292 X:14260425-14260447 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1186976437 X:14911531-14911553 GTGTGTAAAAAGAAAGAGGAAGG + Intronic
1187049999 X:15686357-15686379 TTGTTTAAAAAGGAGGAGGTGGG + Intergenic
1187068121 X:15860970-15860992 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1187302919 X:18068700-18068722 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1187459091 X:19469370-19469392 TTGTGTATAAGGTGTAAGGAAGG - Intronic
1187513211 X:19941442-19941464 TTTTGTATAAGGTATAAGGAAGG + Intronic
1187635146 X:21219787-21219809 TTTTGTATAAGGTACAAGGAAGG + Intergenic
1187636056 X:21229618-21229640 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1187647108 X:21359222-21359244 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1187762862 X:22607087-22607109 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1187837943 X:23454899-23454921 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1187840758 X:23484968-23484990 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1187848054 X:23561822-23561844 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1188096852 X:26033888-26033910 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1188119083 X:26282474-26282496 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1188224334 X:27578381-27578403 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1188466462 X:30487037-30487059 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1188494469 X:30768932-30768954 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1188659065 X:32735736-32735758 TTTTGTATAAGGTGTGAGGAAGG - Intronic
1188704078 X:33304386-33304408 TTTTGTATAAGGTGTGAGGAAGG - Intronic
1188932364 X:36127264-36127286 TTTTGTATAAGGTATAAGGAAGG + Intronic
1189009225 X:37029642-37029664 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1189191417 X:39111233-39111255 ATGAGCATAAAGTAGGGGGAGGG - Intergenic
1189296409 X:39921388-39921410 TTGTGTATAGAGGAGGAAGAGGG - Intergenic
1189552071 X:42103324-42103346 TTTTGTATAAGGTATGAGGAAGG + Intergenic
1189737772 X:44089068-44089090 TTTTGGATGAAGAAGGAGGAGGG + Intergenic
1190258062 X:48779423-48779445 TTTTGTATATGGTATGAGGAAGG - Intergenic
1190272050 X:48872945-48872967 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1190415356 X:50175391-50175413 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1190424613 X:50322392-50322414 TTTTGTATAAGGTATAAGGAAGG - Intronic
1190684506 X:52859412-52859434 TTTTGTATAAGGTGGAAGGAAGG - Intergenic
1190912006 X:54781062-54781084 TTTTGTATATGGTATGAGGAAGG - Intronic
1190919229 X:54835458-54835480 TTTTGTATATGGTATGAGGAAGG + Intergenic
1190967842 X:55319003-55319025 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1191064829 X:56336816-56336838 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1191076232 X:56456371-56456393 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1191098904 X:56704215-56704237 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1191111562 X:56806985-56807007 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1191113568 X:56828537-56828559 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1191132069 X:57025037-57025059 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1191606596 X:63069312-63069334 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1191632392 X:63336187-63336209 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1191725966 X:64281521-64281543 TTTTGTATAAGGTATAAGGAAGG - Intronic
1191753544 X:64569591-64569613 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1191804285 X:65117732-65117754 TTTTGTATAACGTATAAGGAAGG + Intergenic
1191818971 X:65281643-65281665 TTTTGTATAACGTAAGAGGTGGG - Intergenic
1192025807 X:67450230-67450252 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1192076605 X:68004901-68004923 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1192391851 X:70737921-70737943 TTTTGTATAAAGTGTAAGGAAGG - Intronic
1192635526 X:72812724-72812746 TTTTGTATAAGGTCTGAGGAAGG + Intronic
1192646188 X:72908079-72908101 TTTTGTATAAGGTCTGAGGAAGG - Intronic
1192674092 X:73176323-73176345 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1192720795 X:73695613-73695635 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1192721179 X:73700055-73700077 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1192937601 X:75876825-75876847 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1193018341 X:76761262-76761284 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1193044670 X:77039561-77039583 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1193065736 X:77257575-77257597 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1193166786 X:78290132-78290154 TTTTGTATAAGGTATAAGGAAGG + Intronic
1193189952 X:78558989-78559011 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1193222176 X:78938483-78938505 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1193249949 X:79279179-79279201 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1193267314 X:79487071-79487093 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1193284141 X:79692180-79692202 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1193362748 X:80595371-80595393 TTTTGTATAAGGTACAAGGAAGG - Intergenic
1193374486 X:80742081-80742103 TTTTGTATAAGGTATAAGGAAGG + Intronic
1193559087 X:82995402-82995424 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1193712900 X:84900036-84900058 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1193748417 X:85312345-85312367 TTTTGTATAAAGTGTAAGGAAGG + Intronic
1193768879 X:85564803-85564825 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1193791495 X:85820655-85820677 TTTTGTATATAGTATAAGGAAGG - Intergenic
1193835210 X:86334929-86334951 TTATGTATAAGGTATAAGGAAGG + Intronic
1193875319 X:86855510-86855532 TTGTGTATAAGGTGTAAGGAAGG + Intergenic
1194005569 X:88487520-88487542 TTTTGTATAAAGTATAAGGAAGG + Intergenic
1194015064 X:88609156-88609178 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1194185496 X:90769933-90769955 TTTTGTATAAAGTCTAAGGAAGG - Intergenic
1194420360 X:93665427-93665449 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1194509760 X:94779368-94779390 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1194517007 X:94867207-94867229 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1194805388 X:98320704-98320726 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1194808456 X:98360147-98360169 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1194837025 X:98694317-98694339 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1195164482 X:102205476-102205498 TTGTGTATGATGTAAGAGAAGGG + Intergenic
1195194377 X:102481619-102481641 TTGTGTATGATGTAAGAGAAGGG - Intergenic
1195457884 X:105089997-105090019 TTATTTTTAAAGTAGGGGGATGG + Intronic
1195483350 X:105373688-105373710 TTTTGTATATAGTATAAGGAAGG + Intronic
1195518687 X:105806646-105806668 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1195549638 X:106152985-106153007 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1195794584 X:108630825-108630847 TTTTGTATAAGGTGTGAGGAAGG + Intronic
1195820050 X:108934875-108934897 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1195875877 X:109540001-109540023 TTTTGTATAAAGTGTAAGGAAGG + Intronic
1195876317 X:109545979-109546001 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1195957800 X:110351561-110351583 TTTTGTATATAGTGTGAGGAAGG - Intronic
1196147177 X:112330977-112330999 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1196251647 X:113467904-113467926 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1196293286 X:113968735-113968757 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1196435411 X:115669875-115669897 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1196479237 X:116126159-116126181 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1196494867 X:116312746-116312768 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1196571714 X:117273313-117273335 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1196588981 X:117463373-117463395 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1196597908 X:117566291-117566313 TTTTGTATAAGGTGTGAGGAAGG + Intergenic
1196618841 X:117798516-117798538 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1196638948 X:118036563-118036585 TTTTGTATAAGGTATAAGGAAGG - Intronic
1196756827 X:119164989-119165011 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1196945175 X:120817119-120817141 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1197003889 X:121473100-121473122 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1197008449 X:121532375-121532397 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1197021522 X:121695883-121695905 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1197097888 X:122617026-122617048 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1197131530 X:123010814-123010836 TTTTGTATAAGGTGTGAGGAAGG - Intergenic
1197148971 X:123198882-123198904 ATGTGTTTAAAGTGGGAGCATGG + Intronic
1197239230 X:124105575-124105597 TTTTGTATAAGGTATAAGGAAGG + Intronic
1197291146 X:124659948-124659970 TTTTGTATATGGTATGAGGAAGG - Intronic
1197302531 X:124798859-124798881 TTTTGTATAAGGTATAAGGAAGG + Intronic
1197469526 X:126850371-126850393 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1197527547 X:127581101-127581123 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1197588323 X:128377141-128377163 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1197660438 X:129165256-129165278 TTGTGTATAAAGTACCATGCTGG - Intergenic
1197736670 X:129854820-129854842 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1197909572 X:131466031-131466053 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1198072603 X:133164325-133164347 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1198246227 X:134834680-134834702 TTTTGTATAAAGTATAAGGAAGG + Intronic
1198337726 X:135683605-135683627 TTGTGTATAAGGTGTAAGGAAGG - Intergenic
1198342198 X:135725657-135725679 TTTTGTATAAAGTATAAGGAAGG + Intergenic
1198345792 X:135757638-135757660 TTTTGTATAAAGTATAAGGAAGG - Intergenic
1198347707 X:135775141-135775163 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1198349612 X:135792402-135792424 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1198351517 X:135809675-135809697 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1198353426 X:135826941-135826963 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1198355333 X:135844195-135844217 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1198357243 X:135861478-135861500 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1198359157 X:135878757-135878779 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1198571738 X:137964639-137964661 TTTTGTATAAGGTGGAAGGAAGG - Intergenic
1198572802 X:137975938-137975960 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1198677863 X:139150023-139150045 CTTTGTGTAAAGTAGGAGAATGG - Intronic
1198713257 X:139528507-139528529 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1198798028 X:140420325-140420347 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1199378106 X:147136243-147136265 TTATGTATAAGGTATAAGGAAGG - Intergenic
1199401904 X:147408348-147408370 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1199453279 X:147997428-147997450 TTTTGTATAAGGTATAAGGAAGG - Intronic
1199469384 X:148177312-148177334 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1199700049 X:150368732-150368754 TTTTGTATAAGGTATAAGGAAGG + Intronic
1199918863 X:152374809-152374831 TTTTGTATAAGGTATAAGGAAGG + Intronic
1200321115 X:155190840-155190862 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1200378376 X:155808389-155808411 TTGTGTATATAGCATAAGGAAGG + Intergenic
1200386868 X:155901542-155901564 TTTTGTATAAGGTATAAGGAAGG + Intronic
1200532118 Y:4352021-4352043 TTTTGTATAAAGTCTAAGGAAGG - Intergenic
1201229586 Y:11851122-11851144 TTTTGTATATAGTATAAGGAAGG - Intergenic
1201248892 Y:12035685-12035707 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1201279986 Y:12333626-12333648 TTGTTTAGAAAACAGGAGGAAGG - Intergenic
1201432193 Y:13914220-13914242 TTTTGTATAAAGTGTAAGGAGGG - Intergenic
1201435744 Y:13956781-13956803 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1201441899 Y:14017362-14017384 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1201442671 Y:14025345-14025367 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1201491417 Y:14545947-14545969 TTTTGTATAAGGTATAAGGAAGG + Intronic
1201493829 Y:14571768-14571790 TTTTGTATAAGGTATAAGGAAGG + Intronic
1201535420 Y:15042619-15042641 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1201591724 Y:15622630-15622652 TTTTGTATAAAGTGCAAGGAAGG - Intergenic
1201638598 Y:16153760-16153782 TTGTGGATAAAGAAGAAGGCAGG - Intergenic
1201689587 Y:16748202-16748224 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1201709046 Y:16969331-16969353 TTTTGTATAAGGTGGAAGGAAGG + Intergenic
1201712055 Y:17003180-17003202 TTCTGCATAATGTATGAGGAAGG + Intergenic
1201892875 Y:18961984-18962006 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1201895610 Y:18989793-18989815 TTTTGTATAAAGTGTAAGGAAGG - Intergenic
1202058928 Y:20865809-20865831 TTTTGTATAAAGTGTAAGGAAGG + Intergenic
1202204633 Y:22393137-22393159 TTTTGTATAAAGTGTAAGGAAGG - Intronic
1202303426 Y:23442269-23442291 TTTTGTATAAGGTATAAGGAAGG + Intergenic
1202567385 Y:26228325-26228347 TTTTGTATAAGGTATAAGGAAGG - Intergenic
1202622051 Y:56824412-56824434 TTTTGTATAAAGTGTAAGGAAGG + Intergenic