ID: 1007988945

View in Genome Browser
Species Human (GRCh38)
Location 6:46234900-46234922
Sequence GGCTGTTTCCCATTCTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 8, 3: 27, 4: 256}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007988934_1007988945 19 Left 1007988934 6:46234858-46234880 CCAATTCCTCTATGACTGGAGGA No data
Right 1007988945 6:46234900-46234922 GGCTGTTTCCCATTCTCAGGAGG 0: 1
1: 0
2: 8
3: 27
4: 256
1007988937_1007988945 13 Left 1007988937 6:46234864-46234886 CCTCTATGACTGGAGGAGGGAGT 0: 1
1: 0
2: 0
3: 12
4: 150
Right 1007988945 6:46234900-46234922 GGCTGTTTCCCATTCTCAGGAGG 0: 1
1: 0
2: 8
3: 27
4: 256
1007988932_1007988945 20 Left 1007988932 6:46234857-46234879 CCCAATTCCTCTATGACTGGAGG 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1007988945 6:46234900-46234922 GGCTGTTTCCCATTCTCAGGAGG 0: 1
1: 0
2: 8
3: 27
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007988945 Original CRISPR GGCTGTTTCCCATTCTCAGG AGG Intronic