ID: 1007988945

View in Genome Browser
Species Human (GRCh38)
Location 6:46234900-46234922
Sequence GGCTGTTTCCCATTCTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 8, 3: 27, 4: 256}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007988937_1007988945 13 Left 1007988937 6:46234864-46234886 CCTCTATGACTGGAGGAGGGAGT 0: 1
1: 0
2: 0
3: 12
4: 150
Right 1007988945 6:46234900-46234922 GGCTGTTTCCCATTCTCAGGAGG 0: 1
1: 0
2: 8
3: 27
4: 256
1007988934_1007988945 19 Left 1007988934 6:46234858-46234880 CCAATTCCTCTATGACTGGAGGA 0: 1
1: 0
2: 0
3: 7
4: 123
Right 1007988945 6:46234900-46234922 GGCTGTTTCCCATTCTCAGGAGG 0: 1
1: 0
2: 8
3: 27
4: 256
1007988932_1007988945 20 Left 1007988932 6:46234857-46234879 CCCAATTCCTCTATGACTGGAGG 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1007988945 6:46234900-46234922 GGCTGTTTCCCATTCTCAGGAGG 0: 1
1: 0
2: 8
3: 27
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007988945 Original CRISPR GGCTGTTTCCCATTCTCAGG AGG Intronic
902782492 1:18713448-18713470 AGCTGTAGTCCATTCTCAGGAGG + Intronic
903272638 1:22200626-22200648 GCCTTGTTCCCAATCTCAGGGGG + Intergenic
905701602 1:40020273-40020295 GCCTGTCTCCCATTCTTAGATGG + Intergenic
909404582 1:75273445-75273467 GTCTTTTTCCAGTTCTCAGGGGG + Intronic
909639464 1:77855961-77855983 GTCTTGTTCCCATTCTCAGAGGG + Intronic
909721991 1:78783569-78783591 GTCTCATTTCCATTCTCAGGGGG - Intergenic
909948025 1:81685703-81685725 GTCTTGTTCCCATTCTCAGAGGG + Intronic
910077987 1:83302911-83302933 GCCTTTTTCCCATTCTTAGAGGG - Intergenic
912041099 1:105391828-105391850 AGCTCTTTCTCTTTCTCAGGGGG - Intergenic
914931302 1:151936319-151936341 AGCTCTTTCTCTTTCTCAGGGGG - Intergenic
915083752 1:153370216-153370238 AGCTCTTTCTCCTTCTCAGGGGG - Intergenic
916330576 1:163611690-163611712 GGGTGGTTCACATTCTCAAGGGG + Intergenic
916944953 1:169717131-169717153 AGCTCTTTCTCTTTCTCAGGGGG + Intronic
917345342 1:174022831-174022853 GGCTGTTTCACAGCCTTAGGAGG - Intergenic
919728873 1:200900540-200900562 GGCTGTCCTCCTTTCTCAGGAGG + Intronic
920726633 1:208441804-208441826 GTCTTGTTCCCATTCTCAGAGGG + Intergenic
922754148 1:228085366-228085388 GGTAGTTTCACATTCTCAGGTGG + Intronic
922802967 1:228372423-228372445 GGCTGTGTCCCAGTCAGAGGAGG + Exonic
924380638 1:243460815-243460837 GGCTTGTTCCCTTTCTCAGGTGG + Intronic
1062988167 10:1789578-1789600 GGCTGTTCCGCATCCCCAGGAGG - Intergenic
1063650635 10:7933375-7933397 GGATATTTCCCTTCCTCAGGTGG - Intronic
1064296974 10:14087960-14087982 GGTTGTTTGTCATTCACAGGAGG + Intronic
1065470629 10:26077565-26077587 GTCTTGTTCCCATTCTCAGAGGG + Intronic
1065503796 10:26409197-26409219 TCCTCTTTCCCATTCTCAGGTGG + Intergenic
1066784544 10:38988877-38988899 GTCTTTTTCCAGTTCTCAGGGGG - Intergenic
1067053904 10:43040442-43040464 GGCTGTATCCCACTCACAGCAGG + Intergenic
1067233799 10:44430391-44430413 GTCTTTTTCCAGTTCTCAGGGGG + Intergenic
1067325483 10:45262051-45262073 AGCTCTTTCTCTTTCTCAGGGGG - Intergenic
1068562966 10:58537557-58537579 GTCTTGTTCCCATTCTTAGGGGG - Intronic
1069796198 10:71053402-71053424 TGCTCTGTGCCATTCTCAGGAGG - Intergenic
1074885406 10:117689202-117689224 GGCTGTTGCCCAGACACAGGTGG + Intergenic
1075056463 10:119222538-119222560 GGGCGTTTTCTATTCTCAGGTGG - Intronic
1075390002 10:122085051-122085073 GTCTCTTTCCCATTTTCAGGTGG - Exonic
1076627122 10:131828991-131829013 GTCTTGTTCCTATTCTCAGGGGG + Intergenic
1076737599 10:132465747-132465769 GGCTGTAGCCCCTGCTCAGGAGG + Intergenic
1079273331 11:19009631-19009653 GTCTTGTTCCCATTCTCAGAGGG + Intergenic
1080421801 11:32117432-32117454 AGCTGTTTCCCTATCTGAGGGGG - Intergenic
1081621909 11:44623854-44623876 GGAGGTTTCCCATCCTCTGGGGG + Intergenic
1083087626 11:60167144-60167166 GCCTTTTTCCAGTTCTCAGGGGG + Intergenic
1084221804 11:67685887-67685909 AGCTCTTTCTCTTTCTCAGGGGG + Intergenic
1084225838 11:67714276-67714298 CGCTGTTTCTCCTTCTCAGCCGG + Intergenic
1084594016 11:70106506-70106528 GGCTGCCTGCCAGTCTCAGGTGG - Intronic
1084725893 11:70941702-70941724 GGCTGATTCCATTTCTCATGGGG - Intronic
1088414133 11:109570122-109570144 GTCTTTTTCCTATTCTCAGAGGG - Intergenic
1089644178 11:119867153-119867175 GGCTGTTTACCAAGCCCAGGTGG - Intergenic
1089879083 11:121756197-121756219 GGTTGTTTGTCATTGTCAGGGGG - Intergenic
1090158961 11:124471138-124471160 GCCTCTTTTCCATTCTAAGGGGG + Intergenic
1090169299 11:124584759-124584781 TGCTGTTTCCCAGCCTCAAGAGG + Intergenic
1090757875 11:129810142-129810164 GGCTTGTTCCAGTTCTCAGGGGG - Intergenic
1091210128 11:133850443-133850465 GTCTTGTTCCCATTCTCAGAGGG + Intergenic
1092629552 12:10363404-10363426 GGCTCTTTCTCTTCCTCAGGGGG - Intergenic
1093287507 12:17282921-17282943 GTCTTTTTCCAATTCTCAGAGGG - Intergenic
1096032207 12:48429240-48429262 GTCTTGTTCCCATTCTCAGAGGG - Intergenic
1096386639 12:51198903-51198925 GGCTCTTCCCCATCCTCATGTGG - Intronic
1097490567 12:60264409-60264431 GGCTTGTTCCAGTTCTCAGGGGG + Intergenic
1099386804 12:82023794-82023816 GTCTTTTTCCATTTCTCAGGGGG - Intergenic
1099531301 12:83784708-83784730 GGCTATTTCACAGTCACAGGAGG + Intergenic
1103760436 12:123245972-123245994 GTCTTGTTCCAATTCTCAGGGGG + Intronic
1103932108 12:124456352-124456374 GGCTGCGGCCCATTCTCTGGGGG + Intronic
1104350258 12:128039112-128039134 GGCTCTTTCCCAGGATCAGGAGG - Intergenic
1106189165 13:27435890-27435912 GGCTGTTTCCCTTTTTTAGGAGG - Exonic
1106407594 13:29487516-29487538 GTCTGTTTCCCAGTGGCAGGGGG - Intronic
1108924094 13:55716604-55716626 GTCTTGTTCCAATTCTCAGGGGG + Intergenic
1109484871 13:63005711-63005733 GTCTTTTTCCAGTTCTCAGGGGG - Intergenic
1110721261 13:78764966-78764988 GGCCATTGCCCATTCTGAGGTGG - Intergenic
1113274623 13:108714981-108715003 TACTGTTTCCCATTCACAGCCGG + Intronic
1113534587 13:111055144-111055166 GTCTTTTTCCAGTTCTCAGGGGG + Intergenic
1113673867 13:112195088-112195110 GGCTGATTCCGATTCCCAGGAGG + Intergenic
1114082143 14:19210629-19210651 AGCTCTTTCTCTTTCTCAGGGGG + Intergenic
1114483059 14:23047290-23047312 GGCTGGTTCCCTCTCTCAGCTGG + Exonic
1114815295 14:25950311-25950333 GGATACTTCCCATTCTTAGGAGG - Intergenic
1116069875 14:40030407-40030429 GTCTGTTTCCCATTTTTAGGGGG - Intergenic
1118874383 14:69770977-69770999 GGCTGTTTTCCATTTTAGGGTGG + Exonic
1119173900 14:72555154-72555176 TGATGTTTCCCTTTCTAAGGTGG - Intronic
1119380575 14:74225691-74225713 GGCTGATTCTCCTCCTCAGGAGG - Intergenic
1121575758 14:94985258-94985280 GACTTTTTCCTGTTCTCAGGGGG - Intergenic
1122357481 14:101132319-101132341 GGCTGCTTGCCAGGCTCAGGGGG + Intergenic
1122380741 14:101305200-101305222 GGCTGTGACCCAGCCTCAGGAGG + Intergenic
1122823912 14:104360447-104360469 TTCTGTTCCCCATTCACAGGTGG + Intergenic
1123470632 15:20549591-20549613 GGCTCTTTCTCATTCTCAGGGGG - Intergenic
1123647428 15:22451109-22451131 GGCTCTTTCTCATTCTCAGGGGG + Intergenic
1123730933 15:23144569-23144591 GGCTCTTTCTCATTCTCAGGGGG - Intergenic
1123749072 15:23341995-23342017 GGCTCTTTCTCATTCTCAGGGGG - Intergenic
1124281443 15:28365878-28365900 GGCTCTTTCTCATTCTCAGGGGG - Intergenic
1124301261 15:28545743-28545765 GGCTCTTTCTCATTCTCAGGGGG + Intergenic
1124561962 15:30782559-30782581 AGCTCTTTCTCATTCTCAGGGGG - Intergenic
1124696245 15:31867069-31867091 GGGTGTTTCCCATGCTTAGATGG - Intronic
1125743813 15:41985800-41985822 GGCTGCAGCCCATGCTCAGGAGG + Intronic
1126812068 15:52416882-52416904 AGCTCTTTCTCTTTCTCAGGGGG + Intronic
1128163934 15:65444454-65444476 AGCTGTTACCCATACTCAGGGGG + Exonic
1128931691 15:71710085-71710107 AGCTCTTTCCCATCCTGAGGGGG + Intronic
1129928580 15:79388156-79388178 GTCTTTTTCCCAATCTCAGAAGG + Intronic
1131202599 15:90412670-90412692 GGCTGTTTCCAATGCCTAGGTGG + Intronic
1131711072 15:95057392-95057414 GTCTTATTCCTATTCTCAGGGGG + Intergenic
1132242115 15:100265956-100265978 GGCTGGTTCCCACACTCCGGTGG - Intronic
1134334016 16:13277984-13278006 GTCTTGTTCCCATTCTCAGAGGG + Intergenic
1135077910 16:19410258-19410280 AGCTCTTTCTCTTTCTCAGGGGG + Intergenic
1135973537 16:27089718-27089740 GGCTGTTTCCCACCCTGGGGGGG - Intergenic
1138023786 16:53506364-53506386 GGCTGTGTCCCAGCCCCAGGTGG + Intergenic
1138391805 16:56675848-56675870 GGCCATTTCCCATTCCCAGGTGG - Intronic
1139229709 16:65272083-65272105 TTCTGTTTCCCATTAGCAGGGGG - Intergenic
1139413238 16:66783158-66783180 GTCTTTTTCCCAGTCTCAAGGGG + Intronic
1139584167 16:67890780-67890802 AGCTCTTTCTCTTTCTCAGGGGG + Intergenic
1143238228 17:5421301-5421323 GGCTGTTTCTCATTCTCTCCAGG - Exonic
1143562534 17:7704396-7704418 GGCTGTTTCCAATTATCCTGGGG - Intergenic
1146897479 17:36554760-36554782 GGCTGTATCCTGTTCTCAGAGGG + Intronic
1148780486 17:50118473-50118495 GGGTGTCTCCCCGTCTCAGGTGG + Intronic
1149851090 17:60034585-60034607 AGTTGTTTCCCAGGCTCAGGAGG - Intergenic
1149859076 17:60111929-60111951 AGTTGTTTCCCAGGCTCAGGAGG + Intergenic
1150792002 17:68206138-68206160 GGCTGATTCCGATTATCTGGAGG + Intergenic
1151752770 17:76050355-76050377 GCCTGTGTCCCCTTCTCAGGTGG - Intronic
1152176652 17:78792408-78792430 GGCTGTTCCCCATCCTCTGTGGG - Intronic
1154280481 18:12997621-12997643 AGCTCTTTCTCTTTCTCAGGGGG + Intronic
1154297531 18:13163339-13163361 CGCTGTTTCCCATGCACATGTGG + Intergenic
1155597176 18:27501900-27501922 AGCTGATTCCCATTCACAGAGGG + Intergenic
1156123032 18:33868070-33868092 CTCTGTTGCCCATTCTCAGGTGG + Intronic
1162804449 19:13129767-13129789 GGTTGGCTCTCATTCTCAGGAGG + Intronic
1163867689 19:19788040-19788062 GGCTGTTTTCCAGTCTGAGATGG - Intronic
1164003350 19:21127286-21127308 AGCTCTTTCTCTTTCTCAGGAGG + Intergenic
1164017198 19:21263858-21263880 AGCTCTTTCTCTTTCTCAGGAGG - Intronic
1164082037 19:21866933-21866955 AGCTCTTTCTCTTTCTCAGGGGG + Intergenic
1165450916 19:35882029-35882051 GGTCGGTTCCCATTCCCAGGAGG - Intergenic
1165562496 19:36692069-36692091 GGTTGTTTCCAGTTCTGAGGTGG + Intronic
1167368307 19:49065929-49065951 GGCTCTGTCCCCTTCTCGGGGGG - Intergenic
925127077 2:1465961-1465983 GTCTTGTTCCCATTCTCAGAGGG + Intronic
925423418 2:3729620-3729642 GCCTGTCTCCCAGTCTCTGGCGG - Intronic
927253855 2:21022372-21022394 GGCTGTATTCCATTATCACGAGG + Intronic
929072550 2:38048410-38048432 GGCTGTTTTCCTTTCTCCAGAGG - Intronic
931536183 2:63279532-63279554 GTCTTTTTCCAGTTCTCAGGGGG - Intronic
931993211 2:67811624-67811646 GTCTTGTTCCCATTCTCAGAGGG - Intergenic
932293102 2:70600037-70600059 GCCTTGTTCCCAATCTCAGGAGG + Intergenic
933111647 2:78408565-78408587 GGCTCTCTCCCAGTCACAGGAGG + Intergenic
935762890 2:106337723-106337745 GGCTGTGTCTCATTCTCCTGGGG + Intergenic
937312044 2:120908584-120908606 GGCAGTTTCCCCTTCCTAGGAGG + Intronic
937362950 2:121241658-121241680 GGCAGGTTTCCATTCTCAGTGGG - Intronic
938070652 2:128306598-128306620 GGCGCTTTCTAATTCTCAGGTGG + Intronic
938494438 2:131785970-131785992 AGCTCTTTCTCTTTCTCAGGGGG - Intergenic
939154318 2:138506075-138506097 AGCTGTTTAACATTCTCTGGTGG - Intronic
940470091 2:154086011-154086033 GGTTGTTGCCCATTGTCAGTAGG + Intronic
942910739 2:181241473-181241495 GGCTGTTTTCCATCCTCAGATGG + Intergenic
944962020 2:204885902-204885924 AGCTCTTCCCCCTTCTCAGGCGG - Intronic
945055903 2:205868801-205868823 TGCTGTTTCCCAGACACAGGTGG - Intergenic
946526718 2:220528952-220528974 GGCAGATTCCCATTCTCATGGGG + Intergenic
947792880 2:232877891-232877913 TGCTGTTTCCCATCCTCAAAAGG + Intronic
948036648 2:234863437-234863459 GGCTGAAGCCCATTCTGAGGGGG + Intergenic
1169193115 20:3670109-3670131 GGCTGCTTCTCATCCCCAGGCGG - Intronic
1169616181 20:7448341-7448363 GCCTTTTTCCAGTTCTCAGGGGG + Intergenic
1171785539 20:29460604-29460626 GTCTTGTTCCAATTCTCAGGGGG - Intergenic
1172347432 20:34214110-34214132 GACTGGTGGCCATTCTCAGGTGG + Intronic
1173078817 20:39846510-39846532 AGCTGTTTAACAGTCTCAGGAGG - Intergenic
1175424052 20:58853320-58853342 GGCTGTTCCCCGATTTCAGGGGG - Exonic
1175460797 20:59150649-59150671 GGCTGTTTGTTATTCTCAGAAGG - Intergenic
1175564223 20:59959994-59960016 GGCTGCTTCCCACCCTCAGCTGG - Intronic
1176014459 20:62922703-62922725 GGCTGTGTCACTTTCTTAGGTGG - Intronic
1176132500 20:63502277-63502299 GGCTGTGCCCCATGCACAGGTGG - Intergenic
1176287304 21:5024913-5024935 GGCTGGTTCCCATGAGCAGGAGG - Intronic
1176365667 21:6031334-6031356 AGCTCTTTCTCTTTCTCAGGGGG + Intergenic
1176525565 21:7864876-7864898 GTCTTGTTCCAATTCTCAGGGGG + Intergenic
1176711694 21:10155476-10155498 AGCTCTTTCTCTTTCTCAGGGGG - Intergenic
1178659585 21:34494889-34494911 GTCTTGTTCCAATTCTCAGGGGG + Intergenic
1179072183 21:38082012-38082034 GGCTGTTCCCTATTTTCAGGAGG + Intronic
1179869877 21:44238562-44238584 GGCTGGTTCCCATGAGCAGGAGG + Intronic
1180498631 22:15912041-15912063 AGCTCTTTCTCTTTCTCAGGGGG - Intergenic
1181337650 22:22152368-22152390 AGCTCTTTCTCTTTCTCAGGGGG + Intergenic
1183087171 22:35493532-35493554 GGCTGTTTTCCCCTCTCAGCTGG + Intergenic
1184204274 22:42991354-42991376 GGCTGTTCCCCATTCTGCGAGGG - Intronic
1184336771 22:43858438-43858460 GGCTGTTACACATACTCAGGAGG - Intronic
949386244 3:3505451-3505473 GGCTGTTTCACATTCTTGGAAGG + Intergenic
949840887 3:8318573-8318595 GGATGGTTGCCATGCTCAGGAGG - Intergenic
950204207 3:11065475-11065497 GGGTGTTTCCCTTTCCCAGTTGG - Intergenic
950490464 3:13301595-13301617 GGCTGCATCACACTCTCAGGAGG - Intergenic
950744354 3:15074791-15074813 GGCTGGCTCCCACTGTCAGGAGG - Exonic
950867107 3:16197872-16197894 GGTTGTTTGGCATTCTCAGAGGG - Intronic
951250761 3:20391758-20391780 GGCTTCTTCCCATTTTCTGGTGG + Intergenic
951749957 3:26023877-26023899 GTCTTGTTCCAATTCTCAGGGGG + Intergenic
953964866 3:47296444-47296466 GGCTGACTCCCATTCACAGCAGG - Intronic
955980420 3:64519866-64519888 GTCTTGTTCCCATTCTTAGGAGG - Intronic
956854343 3:73261219-73261241 AGCTGTTTCCCCTTCTGAGCAGG - Intergenic
957343902 3:78938137-78938159 GGTGGTTCCCCATTCTCAGGAGG + Intronic
958702068 3:97605014-97605036 GTCTGTCTCCCATTCTAAAGTGG - Intronic
958741401 3:98077751-98077773 GTCTTGTTCCAATTCTCAGGGGG + Intergenic
959021500 3:101192176-101192198 TGGTGTTTTCCATTCTCAGATGG - Intergenic
961773707 3:129268810-129268832 TTCTGCTTCCCACTCTCAGGAGG + Intronic
962815811 3:138998100-138998122 GCCTTGTTCCCAATCTCAGGGGG + Intergenic
963171430 3:142255364-142255386 GTCTTGTTCCCCTTCTCAGGGGG - Intergenic
963814359 3:149813108-149813130 GGCTCTTTCCCACTCTCACGCGG - Exonic
964342445 3:155722083-155722105 GTCTTGTTCCCATTCTGAGGAGG + Intronic
965123745 3:164596544-164596566 GGCTGTTTCACATTCCCAAGGGG + Intergenic
965216532 3:165871232-165871254 GCCTTGTTCCCGTTCTCAGGGGG + Intergenic
966408780 3:179627264-179627286 AGCTCTTTCTCTTTCTCAGGGGG - Intronic
966554126 3:181239773-181239795 TGATGTTTCTCATTCTCAGTAGG - Intergenic
969022177 4:4146039-4146061 CGCTGTTTCTCCTTCTCAGCCGG + Intergenic
974109896 4:57512830-57512852 GGCTTTTTTCCATTCTCTGTGGG + Intergenic
976213521 4:82694065-82694087 GGCTGCTGCCCATGCTCTGGAGG - Intronic
976607959 4:87000244-87000266 GGCTGTTTTCCCTTCAAAGGAGG - Intronic
976874187 4:89834661-89834683 AGCTTTTTCACATTCTCTGGTGG - Intronic
977834092 4:101628773-101628795 GGCTTGTTCCAATTCTCAGGGGG + Intronic
981847781 4:149189228-149189250 GGAAGTTTCCCATTCTCACAGGG - Intergenic
983120754 4:163881527-163881549 GGCTGTTTGCCATGCACTGGAGG + Intronic
983382800 4:167019030-167019052 AGCTGTTTCCCTTTCCCAAGAGG + Intronic
984720095 4:182963332-182963354 GTCTGTTTCCCAGTCTCACAGGG + Intergenic
986673982 5:10167804-10167826 GGTTGATTCCCACTGTCAGGAGG - Intergenic
987053322 5:14166683-14166705 GCCAGTTTCCCTGTCTCAGGAGG + Intronic
987073240 5:14357861-14357883 TGCTCTTTCCCATTCTCCCGAGG - Intronic
987563869 5:19559586-19559608 GACTTGTTCCAATTCTCAGGGGG - Intronic
990891422 5:60654695-60654717 GTCTTTTTCCAGTTCTCAGGGGG + Intronic
992967438 5:82017473-82017495 GTCTTGTTCCAATTCTCAGGGGG + Intronic
994270895 5:97775095-97775117 GTCTTGTTCTCATTCTCAGGGGG - Intergenic
994636379 5:102349424-102349446 GTCTTATTCCCGTTCTCAGGGGG - Intergenic
995878773 5:116820893-116820915 GGGGTTTTGCCATTCTCAGGTGG - Intergenic
997077623 5:130698925-130698947 TGCTGCTTCCCATTCTGAGGTGG - Intergenic
1000359351 5:160433130-160433152 GGCAGGCTGCCATTCTCAGGAGG - Intergenic
1001517005 5:172362866-172362888 GTCTGTTTCCTATCCACAGGGGG - Exonic
1002202630 5:177538824-177538846 GGCTGTTCCCTGTCCTCAGGTGG - Intronic
1003063494 6:2881359-2881381 GTCTTGTTCCCATTCTCAGAGGG - Intergenic
1004599696 6:17136615-17136637 GCCTTGTTCCAATTCTCAGGGGG - Intergenic
1007893051 6:45314215-45314237 GTCTTGTTCCCATTCTCAGGGGG - Intronic
1007988945 6:46234900-46234922 GGCTGTTTCCCATTCTCAGGAGG + Intronic
1008073962 6:47126748-47126770 CGGTGTTCCCCACTCTCAGGTGG + Intergenic
1008767751 6:54940205-54940227 GGCTTTTTCCAATTACCAGGTGG - Exonic
1008991240 6:57604533-57604555 GTCTTGTTCCCATTCTCAAGGGG + Intronic
1009179767 6:60502770-60502792 GTCTTGTTCCCATTCTCAAGGGG + Intergenic
1009202006 6:60757741-60757763 GGCTGTTTTATATTCTCAGCAGG + Intergenic
1010904004 6:81463376-81463398 GGCTTGTTCCAATTATCAGGGGG - Intergenic
1011287729 6:85743180-85743202 GTCCTGTTCCCATTCTCAGGGGG + Intergenic
1011328143 6:86173430-86173452 GGCTGTTTCTCATGCCCAGAGGG + Intergenic
1012115010 6:95285798-95285820 GGCTGTCTCCCAATCTCAGTGGG + Intergenic
1012203109 6:96430366-96430388 GTCTTGTTCCAATTCTCAGGGGG + Intergenic
1013410314 6:109877731-109877753 AGCTCTTTCTCTTTCTCAGGGGG - Intergenic
1013985225 6:116183968-116183990 GTCTTTTTCCAGTTCTCAGGAGG + Intronic
1015551881 6:134420389-134420411 GGCTGTGTCCCTCTATCAGGAGG - Intergenic
1015866890 6:137736195-137736217 GGCTGTTTCCCATCCTCCCCAGG - Intergenic
1018444486 6:163842619-163842641 AGCTGTTTCATGTTCTCAGGTGG - Intergenic
1019452550 7:1107261-1107283 GGCTCTCTCCCATTCCTAGGCGG - Intronic
1019636357 7:2078166-2078188 TATTGATTCCCATTCTCAGGCGG - Intronic
1021323192 7:19236885-19236907 GTCTTGTTCCAATTCTCAGGGGG + Intergenic
1022513978 7:30963951-30963973 CTCTGCTTCCCCTTCTCAGGTGG - Intronic
1023991743 7:45132759-45132781 GGCGGTTTCCCATTACCTGGGGG + Intergenic
1024366994 7:48532067-48532089 GTCTTGTTCCAATTCTCAGGGGG + Intronic
1025119660 7:56290275-56290297 GACTGGTGGCCATTCTCAGGTGG - Intergenic
1029325711 7:99807199-99807221 AGCTCTTTCTCTTTCTCAGGGGG + Intergenic
1031385000 7:121138578-121138600 GGCTGTTTCAGTTTCTAAGGAGG + Intronic
1034346443 7:150388235-150388257 GGCTGTTTTACCTTCTCAGCAGG + Intronic
1034432092 7:151046135-151046157 GGCTGGTTCACAATCTCAGTGGG - Intronic
1034682404 7:152939079-152939101 GGCTGTTTGTCATTCTGGGGAGG + Intergenic
1040395935 8:47000191-47000213 GGCTGTTTTTCATTCTAAGATGG + Intergenic
1040485513 8:47867798-47867820 GCCTTGTTCCCAATCTCAGGAGG + Intronic
1044231009 8:89777744-89777766 GACTGTTTCCTATTTTCAGTGGG + Intronic
1045001277 8:97880347-97880369 AGCTCTTTCTCTTTCTCAGGGGG - Intronic
1045881268 8:107043659-107043681 GTCTTCTTCCCATTCTCAGAGGG - Intergenic
1047530786 8:125672922-125672944 GTCTTGTTCCCATTCTCAGAGGG + Intergenic
1048305041 8:133278272-133278294 CATTTTTTCCCATTCTCAGGAGG + Intronic
1050133313 9:2435746-2435768 GTCTGGTTCCAGTTCTCAGGGGG + Intergenic
1051075801 9:13233925-13233947 GGCTAATTCCCATTCCCAGAAGG + Intronic
1051667169 9:19476328-19476350 GGCTGTCTCCCATTTTCAGGGGG + Intergenic
1052895565 9:33744663-33744685 GGCTTGTTCCAGTTCTCAGGGGG - Intergenic
1053648685 9:40141167-40141189 AGCTCTTTCTCTTTCTCAGGGGG - Intergenic
1053757061 9:41322675-41322697 AGCTCTTTCTCTTTCTCAGGGGG + Intergenic
1054329667 9:63739108-63739130 AGCTCTTTCTCTTTCTCAGGGGG - Intergenic
1054535898 9:66235003-66235025 AGCTCTTTCTCTTTCTCAGGGGG + Intergenic
1056793543 9:89641059-89641081 GGCTGTGTCGCATGCTCTGGCGG + Intergenic
1059076225 9:111196733-111196755 GGCTCTATGCCATTCTCAGGTGG - Intergenic
1060187830 9:121574758-121574780 GGCCCTTTCCCATGCCCAGGGGG + Intronic
1202796449 9_KI270719v1_random:124465-124487 AGCTCTTTCTCTTTCTCAGGGGG - Intergenic
1203446311 Un_GL000219v1:59768-59790 GTCTTGTTCCAATTCTCAGGGGG - Intergenic
1187946726 X:24433451-24433473 AGCTCTTTCTCTTTCTCAGGGGG + Intergenic
1190711315 X:53072784-53072806 GGCTGTTCCACAGTCTGAGGGGG + Intronic
1191067390 X:56364510-56364532 GTCTTGTTCCCATTCTCAGAGGG + Intergenic
1191210235 X:57876741-57876763 AGCTCTTTCTCTTTCTCAGGGGG - Intergenic
1191696906 X:63999512-63999534 AGCTCTTTCTCTTTCTCAGGGGG - Intergenic
1191778130 X:64840684-64840706 ATCTTGTTCCCATTCTCAGGGGG + Intergenic
1192200277 X:69062153-69062175 GCCTGTCTCCCCTTCCCAGGGGG - Intergenic
1192901091 X:75497899-75497921 GTCTTTTTCCAGTTCTCAGGAGG - Intronic
1192969392 X:76215569-76215591 GTGTTTTTCCCATTCTCAGACGG + Intergenic
1193155047 X:78163256-78163278 GTCTTGTTCCCGTTCTCAGGGGG - Intergenic
1193993983 X:88342871-88342893 AGCTGTTTCCCATTATCAGGAGG + Intergenic
1194523833 X:94951339-94951361 AGCTGTTTCCTATTATCAGGAGG + Intergenic
1194633870 X:96320234-96320256 GTCTGGTTCCAGTTCTCAGGGGG + Intergenic
1194926336 X:99829482-99829504 GTCTTGTTCCCATTCTCAGAGGG + Intergenic
1195201183 X:102551496-102551518 GACTGTTTCCCACTCTCTTGAGG + Intergenic
1195757972 X:108218095-108218117 GGCTGTTTCCAATTCTGAGCTGG - Intronic
1196245401 X:113392780-113392802 GGCTCTGTGCCATCCTCAGGTGG + Intergenic
1197070195 X:122287392-122287414 GTCTTGTTCTCATTCTCAGGGGG + Intergenic
1197471895 X:126873761-126873783 GTCTTTTTCCAGTTCTCAGGGGG + Intergenic
1198796811 X:140405881-140405903 GTCTTGTTCCAATTCTCAGGGGG + Intergenic
1200099257 X:153681462-153681484 TGCTGTTTCCCATGATCAGGTGG - Intronic
1200319629 X:155173792-155173814 AGCTCTTTCTCTTTCTCAGGGGG + Intergenic
1200701580 Y:6407022-6407044 GGTTGTTTGCAGTTCTCAGGAGG - Intergenic
1200702362 Y:6413028-6413050 GGCTGTTTGCAATTTGCAGGAGG - Intergenic
1201031749 Y:9751670-9751692 GGCTGTTTGCAATTTGCAGGAGG + Intergenic
1201032531 Y:9757676-9757698 GGTTGTTTGCAGTTCTCAGGAGG + Intergenic
1201571788 Y:15423038-15423060 AGCTCTTTCTCTTTCTCAGGGGG - Intergenic