ID: 1007989370

View in Genome Browser
Species Human (GRCh38)
Location 6:46239342-46239364
Sequence AGAGAGAAAAAAGGTTACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1243
Summary {0: 1, 1: 1, 2: 4, 3: 88, 4: 1149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007989370_1007989373 16 Left 1007989370 6:46239342-46239364 CCTTTGTAACCTTTTTTCTCTCT 0: 1
1: 1
2: 4
3: 88
4: 1149
Right 1007989373 6:46239381-46239403 CATGAGCTCCTATTGAACTTTGG 0: 1
1: 0
2: 1
3: 6
4: 110
1007989370_1007989374 19 Left 1007989370 6:46239342-46239364 CCTTTGTAACCTTTTTTCTCTCT 0: 1
1: 1
2: 4
3: 88
4: 1149
Right 1007989374 6:46239384-46239406 GAGCTCCTATTGAACTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007989370 Original CRISPR AGAGAGAAAAAAGGTTACAA AGG (reversed) Intronic
900531943 1:3158732-3158754 AGAAAGAAAAAAGGGAAGAAAGG - Intronic
901486368 1:9565516-9565538 AGAAAAAAAAAAGGTTACAATGG + Intronic
902803634 1:18847115-18847137 ATAGAGAAAAGAGGTTGCATGGG - Intronic
902972583 1:20064743-20064765 AGAAAGAAAACAGAGTACAAAGG + Intronic
903826598 1:26150109-26150131 AGAGAAAAAAAAATTTACATGGG - Intergenic
905141796 1:35852062-35852084 AGAGAGAACAAGGGACACAAAGG + Intronic
906466806 1:46088883-46088905 AAAAAAAAAAAAGGTCACAAAGG + Intronic
906873034 1:49504912-49504934 AGAGAGAAATAAAGAAACAAAGG - Intronic
907069418 1:51520095-51520117 GTAGAGAAGAAAGGTTATAAAGG - Intergenic
907128260 1:52071868-52071890 AGAGAGAAAGAAGGATGCTATGG - Intronic
907200865 1:52725964-52725986 AGAAAGGAAGAAGGTTGCAATGG + Intergenic
907304016 1:53503872-53503894 AGAGGGAGAAAAGGAGACAAAGG - Intergenic
907595268 1:55713697-55713719 AGAGGGAAATAAGGCTGCAAAGG - Intergenic
907639095 1:56167588-56167610 AGAGAGAAAAAAGTGAAAAAAGG + Intergenic
907749206 1:57246224-57246246 AGGGAGAAAAATGGTTTCATGGG + Intronic
907943889 1:59114931-59114953 AGAGAGAAAGAATGTTGGAAAGG + Intergenic
908203805 1:61824411-61824433 AAAAGGAAAAAAGGTTAAAACGG - Intronic
908307207 1:62832892-62832914 TGAGCAACAAAAGGTTACAATGG + Intronic
908386698 1:63649466-63649488 AGAGAGAAAATATGGTAAAAAGG + Intronic
908419566 1:63946799-63946821 AGACAGAAAAACTGGTACAAAGG + Intronic
908576467 1:65465577-65465599 AACGAGAAAGAAGGTTACCAAGG - Intronic
909101323 1:71352876-71352898 AGAGAGAAAAAAAGAGAGAAAGG - Intergenic
909218065 1:72917390-72917412 AAAAAGAAAAAAGATAACAAAGG - Intergenic
909344785 1:74572463-74572485 TGAGAGAGAAGAGGTGACAAGGG - Exonic
909368085 1:74852083-74852105 AGAAATAAAATAGGTTATAAGGG - Intergenic
909473842 1:76059957-76059979 AGAAAGAAAAAAAGCAACAAAGG - Intergenic
909619535 1:77652022-77652044 AAAAAAAAAAAAGGTTAAAATGG + Intronic
909749602 1:79142579-79142601 AGAGAGGGTAAAGGGTACAAGGG + Intergenic
909867070 1:80686544-80686566 AGAGGGAAAAATGGTTTCATGGG - Intergenic
910365601 1:86461701-86461723 ACAGATAAAAAAGGCTACACAGG - Intergenic
910414969 1:86987915-86987937 ACAGACAAAAAAGGTAAAAAGGG - Intronic
910551793 1:88483294-88483316 AAAGAGCAAAAACCTTACAATGG + Intergenic
910562975 1:88612439-88612461 AGAAAGAACAAAGGGCACAAAGG - Intergenic
910654407 1:89605392-89605414 AGAGAGAAAAGAGGGAAGAAAGG - Intergenic
911272913 1:95825433-95825455 AGATAGAAATAAGATTAGAAAGG - Intergenic
911282197 1:95943689-95943711 AGAAATAAAATAGGTTAGAAAGG - Intergenic
911505406 1:98743512-98743534 AAAGAAAAAAATCGTTACAAGGG + Intronic
911603959 1:99879739-99879761 AGAGAAGAAAACGGTTAAAAAGG - Intronic
911743110 1:101409366-101409388 AGAGAGAAAAAATGGTAAAAAGG - Intergenic
911789122 1:101989153-101989175 AGAGGGAAAAAAGCTTTCCAGGG + Intronic
911850786 1:102817160-102817182 AGAGAGAAAACTGCTTCCAAAGG + Intergenic
911892973 1:103396096-103396118 ATAGAGAAAAAAGAATAAAAAGG - Intergenic
912074581 1:105856600-105856622 AGGGAGAAAAAAGGAAAAAAAGG - Intergenic
912112716 1:106363327-106363349 AGAGGGAAGAAAGGTTTCATGGG + Intergenic
912237258 1:107865574-107865596 AGTGAGAAATAAGGTTAGAAAGG + Intronic
912387855 1:109281267-109281289 AGAGAGAAAAAAGACTAGAGTGG + Intronic
912405549 1:109434576-109434598 GGAGAGAAAAATGGTTTCATGGG - Intergenic
912442251 1:109708122-109708144 AAAGAGGAAAAAGGTTCAAAGGG - Intronic
912839451 1:113026043-113026065 AGAGAGAACAAAAATGACAAGGG + Intergenic
913323654 1:117607354-117607376 AGAAAGCAAAAATGTTAAAAAGG - Intronic
913438279 1:118870252-118870274 ACAGAAAAAAAAGTTGACAAAGG + Intergenic
913467656 1:119158965-119158987 AGAGAGAAACAAGGTTTCTGTGG + Intergenic
914051249 1:144134726-144134748 AAAGAGAAAAAATGAGACAAAGG - Intergenic
914127932 1:144830716-144830738 AAAGAGAAAAAATGAGACAAAGG + Intergenic
914200225 1:145477815-145477837 AGAGAGAAAAAAAGTTATTTTGG - Intergenic
914405855 1:147371714-147371736 AGAGAGAAATAAATTTAAAAGGG - Intergenic
914479341 1:148050967-148050989 AGAGAGAAAAAAAGTTATTTTGG - Intergenic
916234322 1:162570961-162570983 ACAGAGAGAAAAGTTTACAGTGG - Intronic
916302828 1:163294509-163294531 AGAGAGAAAAATGGTTTCATGGG - Intronic
916394468 1:164370691-164370713 GGAGAGAAAATAAGTTACAGAGG + Intergenic
916704769 1:167337792-167337814 AGAGGGAAAAAATGCCACAAAGG + Intronic
917194069 1:172447960-172447982 AGAAAGAAAAAATGTTCCAAAGG + Intronic
917424587 1:174900990-174901012 ATAGAGAAAAAAGAATAAAAAGG - Intronic
917887124 1:179397682-179397704 ATAGAGAAAAAAGAATAAAAAGG - Intronic
917991208 1:180380790-180380812 AGAGAGAAATAAAGGAACAAAGG + Intronic
918168885 1:181976248-181976270 ATAGAGAAAAAAGAATAAAAGGG + Intergenic
918237589 1:182595564-182595586 AGAGAGAAAAAAGGTGTCAGGGG - Intergenic
918661300 1:187092105-187092127 AGAAAGGAAAAAGGTAACATGGG + Intergenic
918668254 1:187178772-187178794 AGAGGGAAAAACGGTTTCATGGG - Intergenic
918760459 1:188397834-188397856 AGAGAGAAAATAAGGAACAAAGG + Intergenic
918834981 1:189450352-189450374 ATAGAGAAAAAAGGTTTAATTGG - Intergenic
918876246 1:190047681-190047703 AGGGATAAAAAAGATTAAAAAGG - Intergenic
919173581 1:193990145-193990167 AGAGAGAAAAAAGGGAAGAAAGG + Intergenic
919182106 1:194100163-194100185 AGAGCACAAAAAGGGTACAAAGG - Intergenic
919367810 1:196686470-196686492 AGATAGAAAAAACATTAAAAAGG - Intronic
919432122 1:197508286-197508308 AGAAGGAAAAAAGGTTACTCTGG - Intronic
919442880 1:197660632-197660654 AGAGACAAAACAAGTAACAAAGG + Intronic
919615344 1:199800713-199800735 AGAGAGAAAAGAGGTGTGAAGGG - Intergenic
920079316 1:203360784-203360806 AAAGAAAAAAAAGGATAAAAAGG - Intergenic
920220690 1:204398175-204398197 AGTGATAAAAAAGTATACAAGGG + Intergenic
920821833 1:209388796-209388818 AGAGAGAAAAAAAGGAAGAAAGG - Intergenic
920843882 1:209577358-209577380 ACAGAAAAACAAGGTTAAAATGG + Intergenic
920872003 1:209802804-209802826 GGAAAGAAAAGAGGTTAAAAGGG + Intronic
921012839 1:211160369-211160391 AGAAAAAAAAAAGGGTAAAAAGG - Intergenic
921259191 1:213370538-213370560 AGAGAGAGAATAGCTTTCAATGG + Intergenic
921442246 1:215201210-215201232 AGAGAGGAAGATGGTTACAGTGG + Intronic
922300912 1:224299725-224299747 AAAGAGAAAAAAGGTGGAAAGGG - Intronic
923589549 1:235307082-235307104 ACAGAGAAAAAAAATTATAATGG + Intronic
923738571 1:236635042-236635064 AAAGAAAAAAAAGGTTACGATGG + Intergenic
923874387 1:238032215-238032237 AAAAAGACAAAAGGTAACAAAGG + Intergenic
923898222 1:238296122-238296144 AAAGAAAAAAAAGGTAATAATGG + Intergenic
924331864 1:242947608-242947630 ATAGAGAAAAAAGAATAAAAAGG + Intergenic
924590781 1:245402236-245402258 ACAGAGAAAAAAGGTTCAAGTGG + Intronic
924654462 1:245960856-245960878 AGAGAGAAAAATAATTACATAGG + Intronic
1063218101 10:3942265-3942287 AAAGAGAAAAAAGGAAAGAAAGG + Intergenic
1063349424 10:5340550-5340572 GAAGAGGAAAAAGGTTAGAAAGG - Intergenic
1063484272 10:6404639-6404661 AAAGAGAAAAAAGGAAAGAAAGG - Intergenic
1063484276 10:6404688-6404710 AGAAAGAAAAAAGGAAAGAAAGG - Intergenic
1063484301 10:6404868-6404890 AGAAAGAAAAAAGGAAAGAAAGG - Intergenic
1063542013 10:6943419-6943441 AAAAAGAAAAAAGGTCACAGTGG + Intergenic
1063549896 10:7021332-7021354 AGAGAGAAAGAAAGAAACAAAGG + Intergenic
1063949227 10:11207099-11207121 ACAGATAGAAAAGGTAACAAGGG - Intronic
1064020682 10:11806122-11806144 AGAGAGAAAGAAGGAGACATGGG + Intergenic
1064059838 10:12128723-12128745 AGAAAGAAAAAAGATAACAGTGG + Intergenic
1064124839 10:12650852-12650874 AGAGAGGAAAAAGGATGCATGGG + Intronic
1064848299 10:19681353-19681375 TGAGAGAAAAAAGAATAAAAAGG - Intronic
1064877083 10:20006179-20006201 AGAAAAAAAAAAGGTAAAAAAGG + Intronic
1065368710 10:24960061-24960083 AGAGAGAAAAATGGCAAAAATGG - Intergenic
1065370399 10:24979313-24979335 AGAAAGAGAAAAGGATTCAATGG + Intergenic
1065388137 10:25154255-25154277 AAAGAAAAAAAAGTTTACAGCGG - Intergenic
1065538841 10:26740949-26740971 AGAGAAAAAATAGGTAAAAAAGG - Intronic
1065672716 10:28138821-28138843 AGAGACAAAGAAGGCTATAATGG + Intronic
1067207477 10:44232177-44232199 AGAGAGAAAAAAGAATGAAAAGG - Intergenic
1067410480 10:46060217-46060239 AAAAAGAAAAAGGGATACAAGGG + Intergenic
1067517042 10:46958344-46958366 AGAAATAAAAAAGATTATAAGGG - Intronic
1067645208 10:48093482-48093504 AGAAATAAAAAAGATTATAAGGG + Intergenic
1067807536 10:49403673-49403695 AGAGAGAAAGAAGGAAAGAAAGG - Intergenic
1067858859 10:49823004-49823026 AGAGGGGAAAAAGGCTAGAAAGG + Intronic
1068054765 10:51997871-51997893 AGAGAGAATAAAAACTACAAGGG - Intronic
1068111213 10:52682894-52682916 AGAGAGAAACAAGGTAAAACTGG + Intergenic
1068126736 10:52850310-52850332 AGAGAGAAAAAAGAATGAAAAGG - Intergenic
1068488509 10:57691343-57691365 AGGGAGAAAGAAAGGTACAAAGG + Intergenic
1068567760 10:58594169-58594191 TTAGAGAAAAAAGGATAAAAAGG + Intronic
1068593872 10:58880830-58880852 AGAGAGAAAGAAAGGAACAAAGG - Intergenic
1069144040 10:64866742-64866764 AAAAAGAATAAAGGTTTCAATGG - Intergenic
1069361556 10:67648730-67648752 AGAGAGAAACAAGGTAAAACAGG - Intronic
1069507640 10:69015375-69015397 AGAAAGAAAGAAGTTTTCAAAGG + Intronic
1069683729 10:70303024-70303046 AGAAAAAAAAAAGGTTAAAATGG + Intronic
1069707183 10:70466237-70466259 AGAAAAAAAAAAGGTTAAAATGG - Intergenic
1069971163 10:72170721-72170743 AGAGGGAAAAAATGCTACAAAGG + Intronic
1070014761 10:72515368-72515390 AGAGAGAAAAAATGACACAGCGG - Intronic
1070686261 10:78484919-78484941 AGAGAGAGAAAAGATCAGAACGG - Intergenic
1071330936 10:84559862-84559884 AGTGAAAGAAAAAGTTACAAAGG - Intergenic
1071461935 10:85905830-85905852 AAAGAGAAAAAAGGAATCAAAGG + Intronic
1071618820 10:87099232-87099254 AGAGAGAAAAAAGCATGCTATGG - Intronic
1071718174 10:88117704-88117726 AGAGAAAAAAAATGTTGCATAGG + Intergenic
1071775552 10:88783706-88783728 AAAAAGAAAAAAGGTCAAAAAGG - Intergenic
1072424587 10:95319302-95319324 AAAAAGAAAAAAGCTTTCAAGGG - Intronic
1072900180 10:99400244-99400266 TGACAGAAAAAAGATAACAAAGG + Intronic
1073003843 10:100306373-100306395 AAAGAGAAAAAAGCTTCCAGAGG + Intronic
1073175467 10:101553794-101553816 ACAGAGAAAAAAGGTTGAAGGGG - Exonic
1073360163 10:102891986-102892008 AGAGAGAGAAATGGTTTCAAAGG + Intronic
1073623895 10:105076444-105076466 AGAGAGAAACAGGTTTATAAAGG - Intronic
1073906852 10:108291929-108291951 AGAGAGAAAAGAAGTTACTGTGG + Intergenic
1073961657 10:108937693-108937715 AAAAAGAAAAAAGATTATAATGG + Intergenic
1074266167 10:111905781-111905803 ATAAAGAAAAAAGGTTTCATTGG + Intergenic
1074677334 10:115866762-115866784 AGCGAGAAGAAAAGCTACAAGGG + Intronic
1075298521 10:121299517-121299539 AGACAGAAAAGAGGAGACAATGG + Intergenic
1075409806 10:122219095-122219117 AGAGAGAAATAAGGATCCAAAGG - Intronic
1075500231 10:122966312-122966334 ATAGAGAAAAAAGAATAAAAAGG + Intronic
1075912140 10:126133717-126133739 AGAGAGAAATGAGGTCAGAAGGG - Intronic
1075915556 10:126163167-126163189 ACAAAGAAAAAAGGTTTCATTGG - Intronic
1076350000 10:129809108-129809130 AGAAAAAAAAAATGTTAGAAAGG + Intergenic
1076588233 10:131564635-131564657 AAAAAAAAAAATGGTTACAATGG + Intergenic
1077369661 11:2175584-2175606 AGAGACAAAACAGGTGACCAGGG + Intergenic
1077770089 11:5207852-5207874 ACAGAAAAAAAACGATACAAAGG - Intergenic
1078404700 11:11060261-11060283 AGAGAGAACAAAGGTTGAAGAGG - Intergenic
1078649363 11:13173123-13173145 AGAGAGAAAAACTGTAACACTGG + Intergenic
1079262412 11:18896300-18896322 TTAGAGAAAAAAGGATAAAAAGG - Intergenic
1079376150 11:19893789-19893811 AGAGAGAAGAAGAGTAACAATGG - Intronic
1079565854 11:21881187-21881209 AGAGAGAGAGAAGGGTAGAAAGG + Intergenic
1079609126 11:22408980-22409002 AGAGAGAAAGAAAGGAACAAAGG + Intergenic
1079643785 11:22837977-22837999 AGCTAGAAAAAATGTTTCAAGGG + Intergenic
1079758438 11:24296875-24296897 AAAGAGAAATAAAGTTTCAAAGG - Intergenic
1079910022 11:26298306-26298328 AGAGAGAAAACAGGCCAAAATGG + Intergenic
1080164742 11:29223652-29223674 ATAGAGAAAAAAGAATAAAAAGG - Intergenic
1080341018 11:31264456-31264478 AGAGAGAGAACAGAGTACAATGG + Intronic
1080979929 11:37389950-37389972 ATAGAGGAAAAAAGTCACAAAGG - Intergenic
1081049754 11:38323993-38324015 GGAGAAAAAAAAGGTTTCTATGG - Intergenic
1081331704 11:41809181-41809203 AGAAAGACAGAAAGTTACAAAGG + Intergenic
1081375517 11:42353492-42353514 AGAGGGAAATAAGGAGACAAGGG + Intergenic
1081538343 11:44012044-44012066 GGACAGAAAAAAGGCTAGAAGGG - Intergenic
1081557703 11:44181280-44181302 GAAGGAAAAAAAGGTTACAAAGG - Intronic
1081664742 11:44910201-44910223 AGGGAGAAAACAGGTCCCAAAGG - Intronic
1081769655 11:45641368-45641390 AGAGATGAAAAAGCATACAATGG + Intergenic
1082612227 11:55314169-55314191 AGAGGGAAAAAAGTGTTCAAAGG + Intergenic
1082683460 11:56208606-56208628 AGAGAGAAAAAGGAAGACAAAGG - Intergenic
1082734309 11:56839103-56839125 AGAGGGAAAAATGGTTTCATGGG - Intergenic
1082887462 11:58102266-58102288 TGAGAGGAAAAAAGTTAAAAAGG - Intronic
1082974103 11:59055249-59055271 AAAGAGAAAATAGGTTAGAAGGG + Intergenic
1082978514 11:59099040-59099062 AAAGAGAAAATAGGTTAGAAGGG + Intergenic
1083733181 11:64664484-64664506 AAAAAAAAAAAAGGTTACTATGG + Intronic
1084143428 11:67249970-67249992 AGAGAGAAGAAAGGTCACGTTGG - Intronic
1085062208 11:73457767-73457789 AAAGAAAAAAAAGGCTAAAATGG + Intronic
1085511962 11:77092985-77093007 AGAAAGAAAAAAGGAAAAAAAGG + Intronic
1086747745 11:90451469-90451491 AGTGAGAAAGAAGGTGAAAATGG + Intergenic
1086771539 11:90773836-90773858 ATAGAGAAAAATGTTTAAAAAGG - Intergenic
1087165015 11:94994469-94994491 AGAGAGAAAGAAAGTTAAGAGGG + Intronic
1087309853 11:96528781-96528803 ATAGAGAAAAAAGAATAAAAAGG + Intergenic
1087337460 11:96862738-96862760 ATAGAGAAAAAAGAATAAAAAGG - Intergenic
1087435073 11:98106119-98106141 AGAGAAAAAAAAAGTAAGAAAGG + Intergenic
1087488740 11:98793887-98793909 AGAGAGGAAAAAAGGAACAAAGG + Intergenic
1087808744 11:102586446-102586468 AGAAATAAAAAAGGTCATAAAGG - Intronic
1087904192 11:103676438-103676460 AGAGTGATAAAAGATTCCAAGGG - Intergenic
1088100093 11:106145112-106145134 AGACATAAAAAATGTTATAAAGG + Intergenic
1088150730 11:106741714-106741736 ATTTAGAAAAAAGTTTACAATGG + Intronic
1088186871 11:107180396-107180418 AGAGACAAAAAACATTAAAATGG + Intergenic
1088240217 11:107766347-107766369 AGAGAGAAAGAAAGGAACAAAGG + Intergenic
1088417206 11:109602513-109602535 GGAGAGAAAAAATGTCCCAATGG + Intergenic
1088827523 11:113508148-113508170 AGAGAGAAAGAAGGGGAGAAAGG + Intergenic
1088899355 11:114103530-114103552 AAAGAGAAAAAAGATTCCACCGG - Intronic
1088961640 11:114672414-114672436 ACAGAGAAAAAAAGATGCAAAGG + Intergenic
1088983324 11:114883569-114883591 GGAGAAAAAGAAGGTGACAAAGG - Intergenic
1089060251 11:115620543-115620565 AAAAAAAAAAAAGGTTAAAATGG - Intergenic
1089409170 11:118224470-118224492 AGATAGTAAAAAGTTTACTATGG - Intronic
1089424170 11:118357334-118357356 AAAAAAAAAAAAGGTTAAAATGG - Intergenic
1089447948 11:118568658-118568680 AAAGAAAAAAAAAGTGACAATGG - Intronic
1090163098 11:124516592-124516614 AGAGATAAAAACGGCAACAATGG + Intergenic
1090494695 11:127199068-127199090 AGAAAGAAAAAGCTTTACAATGG - Intergenic
1090814772 11:130283025-130283047 AAAAAAAAAAAAGGTTAGAATGG - Intronic
1090822818 11:130359983-130360005 AGAGAGAAAAAGGGGAAGAAAGG - Intergenic
1091597672 12:1889721-1889743 AGAGAGAAAAAAAGTTATATTGG + Intronic
1092305302 12:7294377-7294399 AGAGAGAGAAATTGTTTCAAAGG + Intergenic
1092359805 12:7826940-7826962 AGAGAGAAGAAAGGAAAGAAAGG - Intronic
1092666109 12:10800338-10800360 AGAGAGAAAAAAAGTTTTCATGG - Intergenic
1092798737 12:12141215-12141237 AGAAAGAAAAAAGGAAAGAAGGG + Intronic
1092830999 12:12444198-12444220 AGAGAAAATAAAGGTTATGAGGG + Intronic
1092952040 12:13514000-13514022 AGAAATAAAAAAGATTATAAGGG - Intergenic
1093050825 12:14502965-14502987 AGAAAGAAAAAAAGCCACAAGGG - Intergenic
1093586457 12:20843140-20843162 AGAGAGTATAAAGGTTAAAGAGG - Intronic
1093623921 12:21324278-21324300 AGAGAGAAAAATTGTTTCAAAGG - Intronic
1093710163 12:22320904-22320926 AGAGAGAAGAAAGGAAAGAAAGG + Intronic
1093808605 12:23465690-23465712 ATAGAGAAAAAAGAATAAAAAGG + Intergenic
1093966523 12:25332726-25332748 TGAGAGAACAAATGTGACAAAGG + Intergenic
1094277990 12:28700564-28700586 AAAAAGAAAATAGGTTATAAAGG + Intergenic
1094438481 12:30448240-30448262 ACAGTTAAAAATGGTTACAATGG + Intergenic
1094824841 12:34261900-34261922 AGAGAGAAAAAAGAAAAGAAAGG + Intergenic
1095251826 12:39988532-39988554 AGAAAGAAAAAAGAAAACAAAGG + Intronic
1095726708 12:45461807-45461829 GGAGAGAAAAAAAATTAAAAAGG - Intergenic
1095818334 12:46449485-46449507 AGTGAGGCAAAAGGTGACAAGGG + Intergenic
1095907619 12:47394109-47394131 AGAAAGGAAAAAGGTGGCAAAGG - Intergenic
1095919770 12:47517309-47517331 AGAGGGAAAAATGGTTTCATGGG - Intergenic
1096050908 12:48606545-48606567 AGAGAGAAGAATGGTTTCATGGG - Intergenic
1096059515 12:48684870-48684892 AGTGAGAAAAAAGATGAAAACGG + Intergenic
1096123626 12:49104528-49104550 AGAGAAAAACAAGGTTCCAGAGG + Exonic
1096627408 12:52904141-52904163 AGAAAGAAAAAAAATCACAAAGG + Intronic
1096673003 12:53211274-53211296 AGAGACCAAAAAGGGGACAAAGG - Exonic
1097340073 12:58427309-58427331 ATAGAGAAAAAAGAATAAAAAGG + Intergenic
1097350607 12:58544509-58544531 AGAGAGAAGAAAGGGAAGAAGGG - Intronic
1097368078 12:58742179-58742201 GGAGAGAAAAATGGTTTCATGGG + Intronic
1097378495 12:58866162-58866184 AAAGAAAAAAAAAGTTCCAAAGG + Intergenic
1097438204 12:59576782-59576804 AGGGAAAAAAAAAGTTACAGAGG + Intergenic
1097529872 12:60785296-60785318 AGAGAGAAAGAAAGGAACAAAGG + Intergenic
1098089024 12:66881187-66881209 AGAGAGAAAAAAAGAGAAAAAGG + Intergenic
1098168648 12:67723186-67723208 AGACAGAAAAAAGGGTACTCAGG + Intergenic
1098413951 12:70212479-70212501 AGAGAGAAAGAAAGGAACAAAGG - Intergenic
1098561869 12:71882612-71882634 AGAAATAGAAATGGTTACAAAGG - Intronic
1098842931 12:75498654-75498676 AGAAAGAAAAAAAATTAAAAGGG - Exonic
1098887046 12:75970620-75970642 AGAGAGAAAACAGATTAAACAGG + Intergenic
1098922425 12:76314720-76314742 AGAGAGAAAAAAAGAAACACAGG + Intergenic
1098992671 12:77081417-77081439 AAAAAAAAAAAAGGTTAAAATGG + Intergenic
1099085281 12:78238833-78238855 AGAAAGAAAAAAGATCACATTGG + Intergenic
1099372943 12:81860091-81860113 TGGTAGAAAAAAGGTTACCAAGG - Intergenic
1099592010 12:84604903-84604925 AGAGAGAAAACAGTTTTCACTGG + Intergenic
1099793125 12:87362352-87362374 AGAGAGAAAAAAGAATGAAAAGG - Intergenic
1100067706 12:90670162-90670184 GGAGAGAAAAATGCTCACAATGG - Intergenic
1100280292 12:93112124-93112146 AGAGAGTAAGGAGGGTACAATGG - Intergenic
1100546978 12:95612789-95612811 AGAAAAAAAAAAGTTTCCAAAGG - Intergenic
1100646134 12:96533335-96533357 AGAGGGAATAAAGGCTGCAAAGG - Intronic
1100744578 12:97631845-97631867 AGAGAAATAGAAGGATACAAAGG + Intergenic
1101050227 12:100855224-100855246 GGGGAGAAAAAAGGATACGATGG - Intronic
1101184482 12:102260088-102260110 AGTGAGAGAAAATGTTAAAAGGG - Intergenic
1101301469 12:103487507-103487529 AGTGAGAAAGAAGGTTAACAAGG - Intronic
1101927918 12:108988749-108988771 AGAGAGAAAAGAAGTAAGAAAGG - Intronic
1101928551 12:108993326-108993348 GGGGAAAAAAAAGGTTAAAATGG + Intronic
1102528144 12:113526545-113526567 AGAAAGAAAAAAGGTAACTCAGG - Intergenic
1103496997 12:121370615-121370637 AAAAAAAAAAAAGGTTAAAATGG + Intronic
1103838465 12:123843438-123843460 AGAGACAACAAAGATTACGAAGG - Intronic
1104034436 12:125088710-125088732 AGAGACAAAACAGGTTATATTGG + Intronic
1104299807 12:127554280-127554302 AAAGAGAAAAAAGATGTCAAAGG - Intergenic
1104429798 12:128706867-128706889 AGAGAGAAAAAAGGAAAAAGTGG - Exonic
1105478760 13:20753995-20754017 AGAGAGAAAGAAAGGAACAAAGG - Intronic
1105811494 13:24000313-24000335 AAAGATAGAAAAGGTTTCAAAGG + Intronic
1105877931 13:24575871-24575893 AGAGAGAAAGAAAGAGACAAAGG - Intergenic
1106007608 13:25785668-25785690 AGAGAGAAAAATGAATAGAAAGG - Intronic
1106368924 13:29112476-29112498 AGGCAGAAATCAGGTTACAAGGG + Intronic
1106410977 13:29511303-29511325 AGAGAGAAAATAAGTCACAGTGG + Exonic
1106519854 13:30487032-30487054 CAGGAGAAAAAAGGATACAAGGG + Intronic
1106985159 13:35338287-35338309 TGAAAGAAAAAAGATTATAAGGG + Intronic
1107026727 13:35809562-35809584 AGAGAGAAAACAGGTTCAGATGG + Intronic
1107251501 13:38368926-38368948 AGAGATAAAATAGTTTAAAATGG - Intergenic
1107254817 13:38412008-38412030 AGAGAGAAAAGAGCTGAAAAAGG + Intergenic
1107408966 13:40141027-40141049 AGAGAGAAGCAAGGATAGAATGG - Intergenic
1107797329 13:44065972-44065994 AGAGAGAAAAAAGGTGAGAGTGG + Intergenic
1107990449 13:45814569-45814591 AGAGAGAATGAAGCTTACTAGGG - Intronic
1108173825 13:47772189-47772211 ATAGAGAAAAAAGAATAAAAAGG - Intergenic
1108244977 13:48504970-48504992 AGAGGAAAAAAAGGCTACGATGG + Intronic
1108256842 13:48619244-48619266 ACAGATAAGAAAGGTTACACAGG + Intergenic
1108472113 13:50777843-50777865 GGGGAGGAAAAAGGTTAGAAAGG - Intronic
1108635170 13:52326715-52326737 AGAGAGAAAGAAAGGGACAAAGG + Intergenic
1108652637 13:52496514-52496536 AGAGAGAAAGAAAGGGACAAAGG - Intergenic
1109073295 13:57798609-57798631 GAAGAGAAAAAAAGTTACTATGG + Intergenic
1109085019 13:57959631-57959653 AGGGAAAAAAAAGTTTACCAAGG - Intergenic
1109145140 13:58770144-58770166 AAAGAGAACAATGGTTAGAAGGG + Intergenic
1109242274 13:59904186-59904208 AGAGAGAAAAAAAGTAAGATAGG + Intronic
1109361599 13:61300600-61300622 ATAGAGAAAAAAGAATAAAAAGG + Intergenic
1109561354 13:64053609-64053631 AGAAAGAAAAATGGATCCAAGGG - Intergenic
1109675423 13:65669683-65669705 ACAGAGATAAAAGGGAACAACGG - Intergenic
1109769034 13:66945604-66945626 AGAGAAAAAATATGTTTCAAGGG - Intronic
1110015509 13:70396000-70396022 AGATAGGAATAAGGTAACAATGG + Intergenic
1110032250 13:70630520-70630542 GTAGAGAAAAAAATTTACAATGG + Intergenic
1110189045 13:72708259-72708281 AAAAAAAAAAAAGGTTAAAATGG + Intergenic
1110345334 13:74440933-74440955 AGAGAGTAAAAAGGTTACAATGG + Intergenic
1110622795 13:77617968-77617990 AGAGAGAAAAAAGTTCAGATTGG - Intronic
1110804459 13:79737644-79737666 AGACCAAAAAAAGGATACAAAGG - Intergenic
1110950991 13:81490631-81490653 AGAGAACAGAATGGTTACAAGGG - Intergenic
1111141315 13:84122904-84122926 AGAAGGGAAAGAGGTTACAATGG - Intergenic
1111219045 13:85180533-85180555 GGAGAGAAAAATGGTTTCATGGG + Intergenic
1111293373 13:86197087-86197109 ATAGAGAAAATAGATTAAAATGG + Intergenic
1111327103 13:86713184-86713206 AAAGAGAAAGAAAGTAACAAGGG - Intergenic
1111335025 13:86809815-86809837 AGAAATAAAAAATCTTACAATGG - Intergenic
1111335870 13:86821864-86821886 AGAGAGAAAAACAGGAACAAAGG + Intergenic
1111364903 13:87230289-87230311 AGAAAGAAAGAAAGTTAGAAAGG - Intergenic
1112195299 13:97219824-97219846 AGTGTGAAAAAAGGTTTGAAGGG + Intergenic
1112408281 13:99139991-99140013 AGAGAGAGAAATTGTTTCAAAGG - Intergenic
1112553030 13:100439893-100439915 AGAAAGAAAAAAGTCTTCAAAGG - Intronic
1112602023 13:100865995-100866017 AGAGAGAAAGAAAGGAACAAAGG - Intergenic
1112967650 13:105217784-105217806 TAAGAGAAAAAAGGTTAAAAGGG - Intergenic
1113064579 13:106360261-106360283 AGAGGGAATATAGGTGACAAAGG + Intergenic
1113183341 13:107657521-107657543 AGAGAAAAGAAAGTTTACAGTGG + Intronic
1113916816 13:113878908-113878930 AGAGAGGAAAAGGTTTTCAAGGG - Intergenic
1114228030 14:20756396-20756418 AGAGACAAAAAGGGGAACAAGGG - Intergenic
1114628525 14:24145217-24145239 AGAGAGATAAGAGGTGACTAGGG - Intronic
1114726955 14:24948133-24948155 AGAAAGCAAAAATGTTTCAAAGG + Intronic
1115164249 14:30430170-30430192 GGAGAGAAGAAAGGAGACAAAGG - Intergenic
1115459798 14:33648028-33648050 AGAGAGAAGAAAGGGTAGCAGGG - Intronic
1115686296 14:35799670-35799692 AGGGAGAAAAAAGGGTACTAAGG + Intronic
1115828379 14:37304202-37304224 TGAGAGAAAAAAGACAACAAAGG - Intronic
1116375829 14:44199525-44199547 AGAAAGAAAAAAGGGAAGAAGGG + Intergenic
1116749386 14:48863901-48863923 AGAGGGAAAGAAGGGGACAAGGG + Intergenic
1117480319 14:56137190-56137212 ACAAAAAAAAAAGGTTACTATGG - Intronic
1118083314 14:62387216-62387238 GGAGAGAAAAATGGTTCCATGGG + Intergenic
1118482045 14:66176994-66177016 AGAGGGAAAAAAAGGTACCAAGG - Intergenic
1118554557 14:67002000-67002022 AAAGGGAAAAAAGGTGACCAGGG - Intronic
1119522530 14:75296419-75296441 AAAGAGAGAAAAGGCTAGAATGG - Intergenic
1119699155 14:76740487-76740509 AGAGAGAAAGAAAGGCACAAAGG - Intergenic
1119950620 14:78740373-78740395 AGAAAAAAAAAAGGAGACAAGGG - Intronic
1120279933 14:82426460-82426482 AGAGAGAAGAAACTTTGCAAAGG - Intergenic
1120327167 14:83045541-83045563 AGAGTGTAAAAAACTTACAACGG - Intergenic
1120458405 14:84761405-84761427 AAAGAGACAAAAAGTTAAAAAGG - Intergenic
1120660809 14:87249197-87249219 AGAATGAAAAAATGATACAAAGG + Intergenic
1121039044 14:90729941-90729963 AAAGAAAAAAAAAGTTCCAATGG + Intronic
1121061420 14:90913655-90913677 ACAGAAAAAAAAGTGTACAAAGG - Intronic
1121212398 14:92217624-92217646 AAAAAAAAAAAAGGCTACAATGG + Intergenic
1121372650 14:93374514-93374536 AGAAAGAAAGAACGCTACAATGG - Intronic
1121664577 14:95662291-95662313 AGAGAGAGAAAAGCTCACATAGG - Intergenic
1121806481 14:96829781-96829803 AGAGAGAAAAGAGTATATAATGG - Intronic
1121963754 14:98285567-98285589 AGAGAGCAAGAAGGTGACCATGG - Intergenic
1122032404 14:98922254-98922276 AAAGAGAAAACAGGTTAAAATGG + Intergenic
1122351685 14:101098638-101098660 AGAGAGAAAGTATGTTTCAAGGG + Intergenic
1122485093 14:102073976-102073998 AAAAAAAAAAAAGGTTAAAATGG - Intergenic
1122488225 14:102095764-102095786 AGAGAGAAAGAACGTTTTAAAGG - Intronic
1124591519 15:31057893-31057915 AGAGAGAGAAAAGAGCACAAGGG - Intronic
1124961601 15:34401045-34401067 ACTGAAAATAAAGGTTACAAAGG - Intronic
1124978227 15:34547267-34547289 ACTGAAAATAAAGGTTACAAAGG - Intronic
1125054444 15:35341071-35341093 ATAGAGAAAAAAGAATAAAAAGG - Intronic
1125122462 15:36178290-36178312 AGAAAAAAAAATGGTAACAAAGG - Intergenic
1125194766 15:37033459-37033481 AGAAAGAAAAAAGGGTACATCGG + Intronic
1125481856 15:40086656-40086678 AGAGAGAAAGGAGGGAACAAGGG + Intergenic
1125925919 15:43563072-43563094 AGAGACAAATAAGGATACCAAGG + Intronic
1125939063 15:43662623-43662645 AGAGACAAATAAGGATACCAAGG + Intronic
1126272439 15:46835976-46835998 AGACAGAAAAAATAGTACAAGGG + Intergenic
1126390768 15:48149185-48149207 AGAGAGAGAATAGGCTCCAAAGG - Exonic
1126532088 15:49721641-49721663 AGGGAGAGAAAAGGTGATAATGG + Intergenic
1126584948 15:50275598-50275620 AGAGAGAAAAGAGGATAAATGGG - Intronic
1127253211 15:57264499-57264521 AAATAGGAAAAAGCTTACAAAGG - Intronic
1127268877 15:57383227-57383249 AGAGAGAAAATAGCTTGCAAAGG + Intronic
1127401659 15:58593114-58593136 ACATAGAAAAAAAGTAACAAAGG + Exonic
1127721883 15:61709986-61710008 TTAGAGAAAAAAGATCACAATGG + Intergenic
1127762976 15:62157969-62157991 AGAGAGAAAAAAAGAAAGAAGGG + Intergenic
1128296458 15:66524807-66524829 AGAAAGAAGAAAGGTGAGAAAGG - Intronic
1129633308 15:77287119-77287141 AGAGATGAAAAAGATTAAAAGGG + Intronic
1129972575 15:79792795-79792817 AGATAGTAAAAAGGTTTCTATGG - Intergenic
1129993932 15:79988752-79988774 TGAGTGAGAAAAGGCTACAAGGG + Intergenic
1130121604 15:81053549-81053571 AGAGACAAAAAAAAATACAAAGG - Intronic
1130433238 15:83870307-83870329 AAAGGGAATGAAGGTTACAAAGG + Intronic
1130668541 15:85890344-85890366 AGTGAGATGGAAGGTTACAAAGG - Intergenic
1130718406 15:86360826-86360848 AGAAATAAAAAGGATTACAAGGG - Intronic
1131731392 15:95285595-95285617 AGAGAGAGAAAGGATTAAAATGG - Intergenic
1131821892 15:96282159-96282181 AGAAAGAAAAAAGATGAGAAAGG + Intergenic
1132264097 15:100451208-100451230 AGAGAGAAAGAAAGAAACAAAGG + Intronic
1133081709 16:3326557-3326579 AGAGAGGAAAAAGGGTGAAACGG - Intergenic
1133407296 16:5535066-5535088 AGAGATAAAAAATGTTATAGAGG + Intergenic
1133942252 16:10319325-10319347 AGAGAGACAAAACCTTCCAATGG - Intergenic
1134759814 16:16704288-16704310 AAAAAAAAAAAAGGTTAAAATGG - Intergenic
1134986258 16:18654917-18654939 AAAAAAAAAAAAGGTTAAAATGG + Intergenic
1135106148 16:19651601-19651623 AAAGAGAAGCAAGGTGACAAAGG - Intronic
1135177798 16:20246352-20246374 GGAGAGCAAAAATGATACAAGGG + Intergenic
1135554436 16:23424320-23424342 AGAGAACAAACAGGCTACAAGGG - Intronic
1135686180 16:24499970-24499992 ATAAAGAAAAAAGGTTTCATTGG - Intergenic
1135819375 16:25668002-25668024 AGAGAGGAAAAAAGGAACAAAGG + Intergenic
1136523465 16:30812807-30812829 AAAAAAAAAAAAGATTACAAAGG + Intergenic
1136909267 16:34133242-34133264 AGACAGAAAAAAGCAAACAAAGG + Intergenic
1136935608 16:34461123-34461145 AGGGAGAAAAAAGGAAAGAAAGG - Intergenic
1136964210 16:34887447-34887469 AGGGAGAAAAAAGGAAAGAAAGG + Intergenic
1137038504 16:35588399-35588421 AGGGAAAAAAATAGTTACAAAGG - Intergenic
1137861926 16:51855515-51855537 GTAGAGAAAAAAGGAAACAAAGG + Intergenic
1137878591 16:52022018-52022040 AGAGAGAGAAAAGGAGAAAATGG + Intronic
1138021903 16:53491781-53491803 AGGGAGAAAAAGTGTTACAACGG - Exonic
1138055877 16:53832710-53832732 TGAAATAAAAAAGGATACAAGGG - Intronic
1138177703 16:54916400-54916422 ACAGAAAAAAAAAGTTACCACGG - Intergenic
1138395380 16:56700289-56700311 AAACAGAATAGAGGTTACAAGGG + Intronic
1138445747 16:57061941-57061963 AGAAAGAAAGAAGGTTTCAGAGG + Intronic
1138738822 16:59282839-59282861 AGAGAGAAATAAAGGAACAAAGG + Intergenic
1138806269 16:60093397-60093419 GGAGGCAAAAAAGGTAACAAAGG - Intergenic
1138893127 16:61168812-61168834 AGAGAGAAAAAAAGACATAAAGG + Intergenic
1138972016 16:62156438-62156460 GGAGAGAAAAGAGATTGCAAAGG + Intergenic
1138976342 16:62213113-62213135 AGAGAAAAAAAAGAATAAAAAGG - Intergenic
1139155051 16:64431489-64431511 AAAAAAAAAAAAGGTCACAAAGG - Intergenic
1139281083 16:65771029-65771051 ACAGATAAGAAAGGCTACAAAGG + Intergenic
1139608212 16:68035334-68035356 AGTAAGAAAACAGGATACAATGG - Intronic
1139813050 16:69638854-69638876 AGAGAAAAAAAAAGTTCCAAGGG - Intronic
1139938618 16:70589220-70589242 AAAGAAAAAAATGGTTAAAATGG + Intronic
1140109952 16:71995429-71995451 AGAGAGAAAATAGGGCAGAAAGG - Intronic
1140146936 16:72320175-72320197 AGAGGGAAAAATGGTTTCATGGG - Intergenic
1140465295 16:75176441-75176463 AGAGAGACAAAAGGGCAGAAAGG + Intergenic
1140736552 16:77902990-77903012 AGAAAGAAAAAAAGTAACACAGG + Intronic
1141270648 16:82537885-82537907 ACAGTGAAAAAATGATACAAAGG - Intergenic
1141546805 16:84775855-84775877 AAAGAGAAAGAAGGATAAAAGGG - Intronic
1141708875 16:85686047-85686069 AGAGAAGAAAAAGATTTCAAAGG + Intronic
1141776628 16:86127486-86127508 ATAGAGAAAAAAGGAAAGAAAGG - Intergenic
1142353944 16:89592786-89592808 AAAGAAAAAAATGGTTACAATGG - Intronic
1142713261 17:1734875-1734897 AGGGAGAAATATGGTTAAAAGGG + Intronic
1142856833 17:2735423-2735445 AAAAAGAAAAAAAGTTACATGGG - Intergenic
1142917810 17:3156613-3156635 AAAGAATAAAAAGGGTACAAAGG + Intergenic
1144587371 17:16495383-16495405 AGAGAGAGAAAAGGAAAGAAGGG - Intergenic
1144821778 17:18080156-18080178 AAAAAAAAAAAAGGTTAAAATGG - Intergenic
1145215607 17:21049606-21049628 AGAGAGAAAAAATGTCTGAAGGG + Intergenic
1145820758 17:27832925-27832947 AAAAAAAAAAAAGGATACAAAGG + Intronic
1146207676 17:30919030-30919052 AAAGAAAAAAATGGTTAAAATGG + Intronic
1146607871 17:34277355-34277377 AGAAAGAAAAAAGGAAAAAAAGG - Intergenic
1146887329 17:36481347-36481369 AGAGATTAAAAAGGTAAAAATGG + Intergenic
1147343033 17:39766502-39766524 AGTGACAGAAAGGGTTACAAAGG + Intronic
1147694762 17:42343180-42343202 AAAAAAAACAAAGGTTACAAAGG + Intronic
1147708385 17:42444711-42444733 AAAAAAAAAAAAGGTTAAAATGG - Intergenic
1148014602 17:44512402-44512424 AGAAAAAAAAAAGGTTAAAATGG - Intergenic
1148014651 17:44512710-44512732 AAAAAAAAAAAAGGTTAAAATGG - Intergenic
1148402046 17:47372158-47372180 AGAGAAAAATAAGGAAACAAAGG - Intronic
1148692095 17:49534826-49534848 AGAAATAAAAATGGTTAAAAGGG + Intergenic
1148933654 17:51147680-51147702 AGAAAGAAAAAAGATTACAGTGG - Intergenic
1148937925 17:51179365-51179387 AAAAAAAAAAAAGGATACAAGGG - Exonic
1149027907 17:52051157-52051179 AGAGAGAAGAAAAGAAACAAAGG + Intronic
1149101459 17:52911442-52911464 AAAGTTAAAAAATGTTACAATGG - Intergenic
1149145535 17:53487782-53487804 AGAAAGAAAAAGGGCTAGAAAGG - Intergenic
1149228701 17:54506432-54506454 TGAGAGAACAAAGGTCAAAATGG + Intergenic
1149275826 17:55034565-55034587 AGAGATAAAACAGATTAGAATGG - Intronic
1149305151 17:55340255-55340277 AGATAGAAAAGAGATGACAATGG - Intergenic
1149382198 17:56105485-56105507 AGAAAGAAAAAAAGATACAAAGG - Intergenic
1149503196 17:57170870-57170892 AAAAAAAAAAAAGGTTAAAATGG + Intergenic
1149674340 17:58446145-58446167 AAAAAAAAAAAAGGTTAAAATGG + Intronic
1149815923 17:59723825-59723847 AGAGAGAAAAATGCTGACATGGG + Intronic
1150191119 17:63240439-63240461 ACAGTGAAAAAAGGTTCTAAGGG - Intronic
1150297705 17:64022354-64022376 AAAAAGAAAAAAGGTTAAGATGG - Intergenic
1150297911 17:64023957-64023979 AAAAAGAAAAAAGGTTAAGATGG - Intergenic
1150525870 17:65921702-65921724 AGAAAGAAAAATGGATGCAATGG + Intronic
1151123078 17:71814618-71814640 AAAGAAAAAAAAAGTTGCAAAGG + Intergenic
1151208360 17:72525134-72525156 AAAAAAAAAAAAGGTTAAAATGG + Intergenic
1151408931 17:73907861-73907883 AGAGAGAAAAACGGTGCCACAGG + Intergenic
1151691414 17:75688321-75688343 TGAGAGAATAAAGGTTTGAAAGG + Intronic
1151722545 17:75865708-75865730 AAAAAAAAAAAAGGTTATAATGG - Intergenic
1151838622 17:76601188-76601210 AGAGAGAAAAAAAGTTAACTGGG + Intergenic
1152790727 17:82277673-82277695 AGAGAGACAAAAGGGGAAAAGGG - Intergenic
1153022805 18:646731-646753 AGAAAGAAAAAAGGAAAGAAAGG - Intronic
1153159378 18:2186075-2186097 AGACAGAAAAAATGTTTCAAAGG - Intergenic
1153698528 18:7668605-7668627 AGAGAGACAGAAGGTCACAGAGG - Intronic
1153781707 18:8500581-8500603 AGTGGGAAACAAGGTGACAAAGG - Intergenic
1153822666 18:8845534-8845556 ACAGAGAATAGAGGTTACCAGGG + Intergenic
1153857169 18:9161324-9161346 AGAGAAAAAAAAGGACAAAAAGG - Intronic
1153897726 18:9582177-9582199 AGGGAGAATAAAGATTAAAATGG + Intronic
1153899044 18:9599041-9599063 AGAAAAAAAAAAGGTTAATATGG + Intronic
1154309777 18:13258060-13258082 AGAAAGAAAAAAGCATACAATGG + Intronic
1154352440 18:13596134-13596156 AGAACAAAAAAAAGTTACAAGGG - Intronic
1154515866 18:15164755-15164777 AGAGAGAAAGAAAGTGAGAAAGG - Intergenic
1154941618 18:21118651-21118673 AGGGAGAAAAAAGATGAAAAGGG - Intergenic
1155102696 18:22628602-22628624 GAAAAGAAAAAAGTTTACAAAGG + Intergenic
1155283643 18:24266459-24266481 AGAAAGAAAAAAGGTGGAAAAGG + Intronic
1155318601 18:24596310-24596332 AAAGAGAAATAAGGTTCCACTGG - Intergenic
1155596855 18:27497968-27497990 AGAGAGAAAAAGGAATGCAATGG + Intergenic
1155701279 18:28747058-28747080 AAAGAGGATAAAGGTCACAAGGG - Intergenic
1155766972 18:29648458-29648480 AGACAGAAAAAACATAACAATGG - Intergenic
1155836959 18:30597846-30597868 AGAAAGAAAAAAGGGAAAAAGGG - Intergenic
1155940054 18:31793875-31793897 AGACATAAAAAAGGTGAAAATGG + Intergenic
1156996273 18:43471538-43471560 AAAGATAAAAAAGGAAACAAGGG + Intergenic
1157036991 18:43986620-43986642 AACGAGAAAAAAGGTTAACAAGG + Intergenic
1157348021 18:46858103-46858125 ACAGAGAAAAAAGGCGGCAAAGG + Intronic
1158004900 18:52661248-52661270 AGACAGAAAACAGGTGAAAAGGG + Intronic
1158067693 18:53432665-53432687 AGAGACAATAAAGGCTAAAAAGG - Intronic
1158095639 18:53767375-53767397 ATAGAGAAAAAAGAATAAAAAGG + Intergenic
1158791620 18:60786449-60786471 AAATAGAAAAGAAGTTACAAGGG + Intergenic
1159112252 18:64073085-64073107 AGAGAGGAAAAACGTCAAAAGGG - Intergenic
1159538931 18:69750442-69750464 AGACATAAAAATGGCTACAAAGG + Intronic
1159922668 18:74240054-74240076 AGAGGGAAATAAGTGTACAAAGG - Intergenic
1159968419 18:74619995-74620017 GGATAGAAAAAAGGGGACAAAGG - Intronic
1160013208 18:75122300-75122322 AGAGACAAGAAAGATTACCAAGG - Intergenic
1160425685 18:78777677-78777699 AGAGAGAGAAAAGGTTGCAAAGG + Intergenic
1161931522 19:7343768-7343790 AAAAAAAAAAAAGGTTAAAATGG + Intergenic
1162429015 19:10615792-10615814 AGAGAGAAAGAAGGTGCCCATGG - Intronic
1162889786 19:13724252-13724274 ATAAAGAAAAAAGGTTTCACTGG + Intergenic
1162942303 19:14018410-14018432 AGAAAAAAAAAATGTTAAAACGG + Intergenic
1163068958 19:14821882-14821904 AGAAAGAAGAATGGTGACAATGG - Intronic
1164121267 19:22267384-22267406 TGAGAGAAAAAAGAATAAAAAGG + Intergenic
1164412265 19:28015813-28015835 AGAGGGTAAAATGGTTTCAAAGG - Intergenic
1164482448 19:28623262-28623284 AGAGAGAAAGAATGGAACAAAGG + Intergenic
1164895824 19:31876822-31876844 AGAGAGTCAAAAGGTGACATTGG + Intergenic
1165000483 19:32757940-32757962 ATAGAGAAAGAAAGATACAAAGG + Intronic
1165107508 19:33481163-33481185 AGAAATAAAAAAGTTTATAAGGG + Intronic
1165818514 19:38659034-38659056 AGAAGAAAAAAAAGTTACAAAGG - Intronic
1168449676 19:56455919-56455941 AAAGAGAAAAAAATTTAAAAAGG + Intronic
1202690655 1_KI270712v1_random:87366-87388 AAAGAGAAAAAATGAGACAAAGG - Intergenic
925064603 2:920575-920597 AGAGAGAAAAATGGGTAGGAAGG - Intergenic
925408138 2:3621606-3621628 AGAGAGGAAGAAGGAAACAAAGG - Intronic
925770505 2:7278092-7278114 AGAGAAAGAAATGGTTAAAAAGG - Intergenic
925881110 2:8353131-8353153 AGAAAGAAAAAAGGAAAGAAAGG + Intergenic
925881716 2:8358147-8358169 AGAGAGAAAAAAGGGAAGAGGGG + Intergenic
925982954 2:9191879-9191901 AGAGAGCAAAAAGTTCCCAAGGG - Intergenic
925993941 2:9276520-9276542 AGAGAAAAAAAAGATGACACAGG - Intronic
926044765 2:9702505-9702527 AGAGAGAACAATGTGTACAAAGG - Intergenic
926221578 2:10939332-10939354 ATAGAGAAAATAGGTTTCATTGG + Intergenic
926332160 2:11834535-11834557 AGAGACAGAGAAGGTGACAAAGG - Intergenic
926406309 2:12556650-12556672 TGACAGAACAAAGATTACAAAGG - Intergenic
926494804 2:13572998-13573020 AGAGACAATAAAGTGTACAAAGG + Intergenic
926636562 2:15186244-15186266 ATAGAGAACAAAGGTCAAAAAGG + Intronic
926654842 2:15390660-15390682 AAATAGTAAAAAGGTTACTATGG - Intronic
926934223 2:18071068-18071090 AGACAGAAAACTGGTAACAAAGG - Intronic
927223237 2:20735310-20735332 AGAGAGAAAATAGACTAAAAAGG - Intronic
927316025 2:21684074-21684096 ATAGTTAAAAAAGGTTAAAATGG + Intergenic
928488682 2:31758391-31758413 AAAAAGAAAAAAGGTTAAATTGG - Intergenic
928556685 2:32433487-32433509 AGAGAGAAAATAGCTCCCAATGG - Intronic
928749866 2:34458875-34458897 GGAGGGAAAAATGGTTACATGGG + Intergenic
928923156 2:36547542-36547564 GGAGAGAAAAAAAGTCCCAAAGG + Intronic
928983931 2:37162417-37162439 AAAAAAAAAAAAGGTTAAAATGG - Intergenic
929352289 2:40971862-40971884 AGAGAGAATCAGGGTTACCATGG + Intergenic
929382626 2:41370165-41370187 AGAGAGAAGAGAAGTGACAAAGG + Intergenic
929457146 2:42074113-42074135 ATAGAGAGAAGAGGTTACATAGG + Intergenic
929473847 2:42224928-42224950 AGAGAGAATAGAGGTTACCGGGG - Intronic
929731783 2:44502424-44502446 AGAAAGTTAAAAGGGTACAAGGG - Intronic
929848125 2:45554407-45554429 AGGGGGAAAAAAGGATACAGTGG - Intronic
929986246 2:46735972-46735994 AGAGAGAGAAATGGTTAAAATGG - Intronic
930132402 2:47865902-47865924 AGGGAGAAAGAAGGAAACAAAGG + Intronic
930287335 2:49447293-49447315 AGGAAGTAAAAAGGTTGCAAAGG - Intergenic
930586109 2:53268743-53268765 AGAGAGAAAAAGGAATGCAAAGG + Intergenic
930687500 2:54325335-54325357 AGAGGGAAAAATGGTTTCATGGG + Intergenic
930756602 2:54980313-54980335 GGAGAGAGAAAATGTTAGAAAGG - Intronic
930794340 2:55372030-55372052 AAAGAAAAAAAAGGTAAAAAAGG - Intronic
931264668 2:60649977-60649999 AGGGAGAAAAAAGGAAAGAATGG + Intergenic
931401899 2:61939029-61939051 AGAGAGAGAAATTGTTTCAAAGG - Intronic
931409381 2:62014532-62014554 AAAAAAAAAAAAGGTTAAAATGG - Intronic
931445104 2:62320629-62320651 AATGATAATAAAGGTTACAATGG + Intergenic
931889878 2:66660484-66660506 ATAGAGAAAAGAGAATACAAAGG - Intergenic
932032458 2:68204245-68204267 AGACAGAAATAAAGTCACAACGG + Intronic
932061101 2:68498657-68498679 AGGGAGAAAAGACATTACAAAGG + Intronic
932617835 2:73246761-73246783 AAAGAGAAAAAAGGAAAAAAGGG - Intronic
933152377 2:78931129-78931151 AGTCAGAAAAACGGTTTCAATGG + Intergenic
933228942 2:79783441-79783463 AGAGAGAAATAAGTTTACATTGG - Intronic
933353567 2:81187673-81187695 AGAGAGAAAAAAAGTTATATTGG - Intergenic
933606741 2:84391362-84391384 AGAGAGAGAAAAGGTGAAGAGGG - Intergenic
934161845 2:89257200-89257222 TGAGAGAAATAAAGTTACATGGG - Intergenic
934205437 2:89925162-89925184 TGAGAGAAATAAAGTTACATGGG + Intergenic
934591880 2:95560889-95560911 AGAGAGAAAAAAACAGACAAAGG - Intergenic
934879302 2:97959776-97959798 ACTGAAAAAAAAGGTTATAAAGG - Intronic
934999480 2:98999515-98999537 AGTGAGAAAAAAGGTGATTAAGG + Intronic
935134316 2:100286165-100286187 ACAGAAAAAAAAAGTTAAAATGG + Intronic
935283306 2:101538912-101538934 AGAGAGAAAATGGGTTGGAAGGG - Intergenic
935420022 2:102857573-102857595 AGAAAGACAAAAAGTTAGAAAGG + Intergenic
935713881 2:105922617-105922639 AGAGAGAAAAAAGGACGCAAGGG + Intergenic
935952925 2:108347118-108347140 AGGGAGAAACAAGGTTAAAAAGG + Intergenic
936603851 2:113928103-113928125 AGGGAGAGAAAAGGTAAAAAGGG - Intronic
936908941 2:117570824-117570846 ATAGAGAAAAAAGAATAAAAAGG - Intergenic
937113270 2:119384005-119384027 AGGGAGAAGAAAGGATAAAAGGG + Intergenic
937563351 2:123253237-123253259 ATAGAAAAAAAAGAATACAAAGG - Intergenic
937606741 2:123809247-123809269 ACAGAGAAAAAAGAATAAAAAGG + Intergenic
937797595 2:126042280-126042302 AGATAGAAAAAAGATTAGACTGG - Intergenic
938053221 2:128193908-128193930 AAAAAGAAAAAGAGTTACAAGGG + Exonic
938680886 2:133688949-133688971 AGAGAGAAATCAGGTTTTAAGGG - Intergenic
938880305 2:135579567-135579589 AAAGAGAAAAATGGTAACTATGG + Intronic
939180004 2:138793565-138793587 ATAGAGAAAAAAGAATAAAAAGG - Intergenic
939207085 2:139120599-139120621 ATAGAGAAAGAAGGTTAGAGAGG - Intergenic
939283000 2:140089320-140089342 TGAGAGAAAAAAATTTAAAAAGG - Intergenic
939342883 2:140923015-140923037 AGTGATGAAAAAGGTTGCAATGG - Exonic
940601347 2:155865149-155865171 AGAAAGAAAAAATGTTCAAAAGG + Intergenic
941006498 2:160252482-160252504 ATAGAGGAAAAAGATTACAATGG + Intronic
941196161 2:162454670-162454692 AAAGAGAATAAAACTTACAAGGG - Intronic
941568762 2:167142580-167142602 AGAGAGAAAGAAAGGTACATGGG + Intronic
941589155 2:167397256-167397278 AGAAAGAAAAAAGGAAGCAAAGG - Intergenic
942273253 2:174298293-174298315 ACAGAGAGAAAAGAGTACAATGG - Intergenic
942823379 2:180143328-180143350 AAATAGGAAAAAGGTTAGAAAGG + Intergenic
944745817 2:202654655-202654677 AAAAAAAAAAAAGATTACAAAGG - Intronic
944956172 2:204812057-204812079 TGATAGAAAAAAGTTTAGAATGG - Intronic
945075985 2:206039836-206039858 AGAAAGAAAAAATATTATAATGG + Intronic
945147054 2:206749194-206749216 AGAAAGAAACAATTTTACAATGG + Intronic
946203666 2:218087831-218087853 AAAGAAAAAAAAAATTACAATGG + Intronic
946463140 2:219887866-219887888 AGGGGGAAAGAAGGTTCCAATGG + Intergenic
946623393 2:221583819-221583841 AGTGAGAACAAAGGTAAAAATGG - Intergenic
946753535 2:222918930-222918952 AGAAAGAAGAAAGGGTACACTGG - Intronic
946800540 2:223411343-223411365 AGAGAGAAAGAAGGCTGCAATGG + Intergenic
947418109 2:229919415-229919437 AAAAAAAAAAAAAGTTACAATGG + Intronic
947429994 2:230019335-230019357 AGACAGTAAAAACGTTACTATGG - Intergenic
947925074 2:233914231-233914253 AGGAAGAAGAAAGGTTACCATGG - Intergenic
948491981 2:238319768-238319790 AAAAAAAAAAAAGGTTATAATGG + Intergenic
948639169 2:239362833-239362855 AGAAAGCAAAAAGATTACAAAGG + Intronic
949054180 2:241916264-241916286 ATAGAGAAAAAAGAATAAAAAGG + Intergenic
1168775464 20:443819-443841 AGAGGGAAAACAGGTTACCTAGG + Intronic
1169010086 20:2243268-2243290 AGTGAGAAAAAAGGTAAAAAAGG - Intergenic
1169378999 20:5090368-5090390 AGAGAGAAAAATGACGACAAAGG + Intronic
1169518513 20:6345318-6345340 ATAGAGAAAAGAGGTTTCATTGG + Intergenic
1169529400 20:6467941-6467963 AGAGAGGAAAAAGAATACTATGG + Intergenic
1169533510 20:6511520-6511542 AGAAATAAAAAAGATTATAAGGG - Intergenic
1170175575 20:13465204-13465226 AGGAAAAAAAAAGGTTAAAATGG + Intronic
1170254064 20:14319845-14319867 AGAGAGAAAAGAGGTGCCAAAGG - Intronic
1170353586 20:15468843-15468865 AGAGAGCAAAAATGTTCCCAAGG - Intronic
1170482242 20:16777540-16777562 AGAGAGAAAACATTTTAAAAGGG - Intergenic
1170742197 20:19067936-19067958 AAAGAGAAAAAAGGATGCTATGG - Intergenic
1171266260 20:23774377-23774399 ACAGAGAAAACAAGTTACCAGGG - Intergenic
1171276012 20:23857024-23857046 ACAGAGAAAACAAGTTACCAGGG - Intergenic
1171316097 20:24196009-24196031 AGAAATAAAAAAGATTATAATGG - Intergenic
1173097564 20:40051229-40051251 AGAGAGAGAACTGGTGACAAAGG + Intergenic
1173198344 20:40934468-40934490 AGATAGAGAAAAGGGGACAAAGG + Intergenic
1173975233 20:47182007-47182029 AAAAAGAAAAAAGGTTAAGATGG - Intronic
1174411555 20:50339889-50339911 AGAGAGAGATGAGGTTATAAGGG - Intergenic
1174503663 20:51003343-51003365 AGAAGGAAAAAAGGATAAAAGGG + Intergenic
1175002951 20:55649584-55649606 ATAGAGAAAAGAGGTAACGATGG + Intergenic
1175035419 20:55995656-55995678 GGAGAGAATAAAAGCTACAAGGG - Intergenic
1175227643 20:57454086-57454108 AGAAAGAAAAAAAGATAGAAGGG + Intergenic
1176186226 20:63781163-63781185 AGAAAGAAAAAAGGAGCCAAAGG + Intronic
1176341626 21:5703429-5703451 ATAGAAAAAAAAAGTTAGAATGG + Intergenic
1176359229 21:5980686-5980708 AGAGAGAAAGAATGAAACAAAGG - Intergenic
1176473880 21:7135581-7135603 ATAGAAAAAAAAAGTTAGAATGG + Intergenic
1176503201 21:7621027-7621049 ATAGAAAAAAAAAGTTAGAATGG - Intergenic
1176535947 21:8101498-8101520 ATAGAAAAAAAAAGTTAGAATGG + Intergenic
1176798899 21:13403059-13403081 AGAGAGAGAAAATTTTAAAAAGG + Intergenic
1176925647 21:14745680-14745702 GGAGGGAAAAAAGGTTTCATGGG - Intergenic
1177010300 21:15724229-15724251 ACAGAGAAAATAGGTCAGAAAGG + Intergenic
1177304157 21:19290921-19290943 TGAGAAAGAAAAGGTTGCAATGG + Intergenic
1177418610 21:20826621-20826643 AGAGAGAAAAAAAGAGAAAAAGG - Intergenic
1177535177 21:22417116-22417138 ATAGAGAAAAAAAGTGACAGAGG - Intergenic
1177768056 21:25481193-25481215 AAAAAGAAAAAAAGTTAAAAAGG + Intergenic
1178247608 21:30968946-30968968 AGAGAGAAAGAAGGAAAGAAAGG + Intergenic
1178306610 21:31495968-31495990 AAAAAAAAAAAAGATTACAATGG + Intronic
1178666673 21:34553461-34553483 AGTCAGAAAAAAGGTTTCAGTGG - Intronic
1179401327 21:41086697-41086719 AGAGAGAAGAGAGGTTAAATGGG + Intergenic
1179764289 21:43557864-43557886 AGAGAGAAAGAATGAAACAAAGG + Intronic
1180381732 22:12145179-12145201 AGAGAGAAAACAGGTTATATCGG + Intergenic
1181714068 22:24711678-24711700 AAAAAAAAAAAAGGTTAAAATGG + Intergenic
1182195074 22:28507356-28507378 ACAGAGAAAAAAGAATAAAAAGG + Intronic
1182491915 22:30678400-30678422 AGAAAGGATAAATGTTACAAGGG - Intergenic
1183173900 22:36208265-36208287 AGAGAAAACAAAGGTTCAAATGG + Intergenic
1183681964 22:39336707-39336729 AAAGAAAAAAAAAGTTACAATGG + Intergenic
1184013406 22:41766904-41766926 AGTGAAAAGAAAGGTTAGAAGGG + Intronic
949349305 3:3109159-3109181 AGACAGAAAAAAGGATGAAATGG - Intronic
949525460 3:4898992-4899014 AGAGAGAGAGAAGGTTAAAATGG + Intergenic
949584785 3:5426845-5426867 CGAGAGAAAAAAGGAAAGAAGGG - Intergenic
949623515 3:5843616-5843638 GGAGAGTAAAAATGATACAAGGG + Intergenic
949688053 3:6600443-6600465 AGAGAGAAAAAAGGAAGGAAAGG + Intergenic
949744569 3:7274384-7274406 AGAGAGAAGAAAGGTGATATAGG - Intronic
949970744 3:9401458-9401480 AGATATAAAAAAGTTTTCAAGGG - Intronic
950373235 3:12548831-12548853 AGATAGAGAAAAGGTAAAAAAGG - Intronic
950512764 3:13442060-13442082 AGACAGAAAAAAGAATACCAGGG - Intergenic
950812027 3:15658224-15658246 AGAGAGAATACAAGTTACACTGG + Intergenic
950980261 3:17296659-17296681 AGAAAGACAAAATCTTACAAGGG - Intronic
951014807 3:17718621-17718643 ACAGTTAAAAATGGTTACAATGG - Intronic
951101844 3:18697632-18697654 AGAGAGAAAAAAATTTTCATTGG - Intergenic
951258914 3:20483071-20483093 ATAGAGAAAAAAGAATAAAAAGG + Intergenic
951328380 3:21333823-21333845 AGAGAGAAAGAAAGAAACAAGGG + Intergenic
951702857 3:25513314-25513336 AGAGAGAAAGAAGGAAAGAAAGG + Intronic
951735685 3:25860662-25860684 ACAGAGAAAAAAGGGTTTAATGG + Intronic
951779111 3:26342991-26343013 AGAGAGAAAAAAGCCTAAAGAGG - Intergenic
951846378 3:27089063-27089085 GGATAGAAATAAGGCTACAAGGG + Intergenic
951870844 3:27360485-27360507 AGAGAGGAAAAATGTGTCAAAGG + Intronic
952360127 3:32622588-32622610 AGAAATAAAAAAGGTTATAAGGG + Intergenic
952551665 3:34485590-34485612 AGAGACAAAGAAGGATACAAAGG + Intergenic
952628782 3:35439875-35439897 ATAGATAAGAAAGGCTACAAAGG + Intergenic
952673482 3:35999316-35999338 AGAGAGAAAAAATAATAAAAAGG - Intergenic
953349777 3:42206842-42206864 AGAAAGAAATGAGGCTACAAAGG - Intronic
953438219 3:42896694-42896716 AGAGAGAACAAAGGAGAGAAGGG - Intronic
953558885 3:43969278-43969300 AAAGCCAAACAAGGTTACAAGGG + Intergenic
953566706 3:44038097-44038119 AGAGAGAAACAAGGAAAAAATGG - Intergenic
953593098 3:44279881-44279903 AGAGAGAAAGAAAGGAACAAAGG - Intronic
954067597 3:48119250-48119272 TGACAGAAAAATGGTTACGACGG + Intergenic
954214830 3:49118779-49118801 AAAAAGAAAAAAGTTTAAAAAGG + Intronic
954656134 3:52195331-52195353 AGAGAGAAAAAGGGAGAGAAAGG + Intergenic
954774121 3:53000234-53000256 TAAGAGAAAAAACATTACAAAGG - Intronic
955336452 3:58090095-58090117 ACACAGAAAAAAGCTTACAGAGG - Intronic
955599234 3:60627465-60627487 AGAAAGAAAAAGGATTACAAGGG - Intronic
955930324 3:64049809-64049831 GGAGAGAAAAAAGGCAACATAGG + Intergenic
955944254 3:64177115-64177137 AAAAAAAAAAAAGGTTAAAATGG - Intronic
957117405 3:76044135-76044157 ATACAGAAAAGAGGTTACAGAGG - Intronic
957125542 3:76155442-76155464 AGATAGAACAAAGTTTACAATGG + Intronic
957287305 3:78232731-78232753 AGAAACAAAAAAAGTTAAAAAGG + Intergenic
957398053 3:79669732-79669754 AGGGAGAAAAAAGGATAAAAGGG + Intronic
957447636 3:80335547-80335569 TGAGAGACTAAAGATTACAAAGG - Intergenic
957612106 3:82481346-82481368 AGTGAGAAAAAAAGGTAGAATGG - Intergenic
957621733 3:82602855-82602877 ACAGAGAAAAAAGATTTCTATGG + Intergenic
957701429 3:83719919-83719941 AGAGAGAGAGAAAGATACAAGGG - Intergenic
957809650 3:85203389-85203411 AGAGAGAAAGAAAGTGTCAAGGG + Intronic
957877550 3:86168667-86168689 AGAGAGAGAGAAAGTTACAGAGG + Intergenic
958137799 3:89519151-89519173 AGAGAGAAGGAAGGAAACAAAGG - Intergenic
958576122 3:95951291-95951313 TGAGAGAACAAAGCTTCCAAAGG + Intergenic
958752521 3:98209387-98209409 AGTGAAAAGAAAGGTAACAAGGG - Intergenic
958865876 3:99501107-99501129 AGAGAGAAAGATGGTGACCAGGG - Intergenic
958976638 3:100674972-100674994 AGAAAAAAAAAAGATTAGAATGG - Intronic
959623808 3:108426953-108426975 AAAGAAAAAAGAGGTGACAAAGG - Intronic
959889888 3:111542691-111542713 AGAGAGAAAAAAGTTAAACAAGG - Intronic
960166637 3:114410255-114410277 AGAGAGAAAACAGGAGAGAAGGG - Intronic
960173945 3:114495391-114495413 AAAGAAAGAAAAGGTTACTATGG + Intronic
960395099 3:117127624-117127646 AGAAATAAAAAAGGTGACAAAGG - Intronic
960604505 3:119490832-119490854 AGAGGAAAAAAAGCTTTCAATGG - Intronic
960885693 3:122391904-122391926 AGAGAGAAAAAAATAAACAATGG - Intronic
961096769 3:124163634-124163656 AGAAAGAAGAAAGGCTATAAAGG + Intronic
961560244 3:127723633-127723655 AAAGAGAAAAAAGCTCAGAAGGG - Intronic
962135991 3:132733363-132733385 AGAAAGAAACAAGATTAAAAAGG + Intergenic
962340103 3:134575301-134575323 AGAAAGAAAAAAGGAAAGAAAGG - Intergenic
962340127 3:134575413-134575435 AGAAAGAAAAAAGGAAAGAAAGG - Intergenic
962340148 3:134575517-134575539 AGAAAGAAAAAAGGAAAGAAAGG - Intergenic
962556837 3:136561937-136561959 AGAGTGAAAGAAGGATAAAACGG - Intronic
963205955 3:142634906-142634928 AAAAAAAAAAAAAGTTACAATGG - Intronic
963756144 3:149236661-149236683 AGACAGAAAAAAGAATAAAAAGG + Intergenic
963777218 3:149451751-149451773 AGAAAGAAAGAAAGATACAATGG + Intergenic
963819477 3:149872513-149872535 AGAGAGAAAAAACTTTACACAGG - Intronic
964116063 3:153137497-153137519 AGGGAGATAAAATGTCACAAAGG + Intergenic
964171262 3:153772143-153772165 AAAGAAAAAAAAAGATACAAAGG + Intergenic
964172483 3:153787486-153787508 AGAGAGATAGAAGGATAGAAGGG - Intergenic
964361786 3:155906033-155906055 AGAAAAAAAAAAAGTGACAATGG - Intronic
964716946 3:159732549-159732571 AGGAAAAAACAAGGTTACAAGGG + Intronic
964821312 3:160773379-160773401 AGAGAGAAAAAAAGGCAAAAGGG + Intronic
965074832 3:163963123-163963145 ATAGAGAAAAGAGGTTAAATTGG - Intergenic
965108459 3:164388441-164388463 GGAGAGAAAAATGGTTTCATAGG - Intergenic
965263476 3:166511926-166511948 ACAGAGAAAAAAGAATAAAAAGG + Intergenic
965337480 3:167444947-167444969 AGAAAGAAAAAAAGCTACATTGG - Intronic
965578003 3:170237828-170237850 AGAGAGAAAAAAGGAAAAACAGG - Intronic
965852873 3:173051754-173051776 AGAGAGAAACAAGGATAGGAAGG - Intronic
966032739 3:175370784-175370806 TGAAAGAAAAAAAGTTACTACGG - Intronic
966413315 3:179665090-179665112 AGAAAAAAAAAAGATTAAAAAGG + Intronic
966454909 3:180103549-180103571 ATAGAGAAAAAAGAATAAAAAGG + Intergenic
966695780 3:182789570-182789592 AGAGAGAAGAAAGGTCAGATAGG - Intergenic
967124997 3:186415347-186415369 AGAGAGAAAGAAAGAAACAAGGG - Intergenic
967299509 3:187998856-187998878 AGGAAGAAAAAAATTTACAATGG + Intergenic
967536626 3:190611820-190611842 AGAGAGAAGAAAGGTAGAAAAGG + Intronic
967791457 3:193553415-193553437 AGAGAAAAAAAATGTTTCAGAGG + Intronic
968535703 4:1127259-1127281 ACAGAGAAAAAAGGTTTAATTGG + Intergenic
968630659 4:1649250-1649272 AGAAAGAAAGAAGGAAACAAGGG + Intronic
968744449 4:2352434-2352456 AGAGGGAAGAAGGGTCACAAAGG + Intronic
970058765 4:12005312-12005334 AAAAAAAGAAAAGGTTACAATGG + Intergenic
970155250 4:13134759-13134781 ATAGAGAAAAGAGATTAAAAGGG + Intergenic
970312706 4:14799052-14799074 TGAGGGAAAAATGGTTTCAATGG - Intergenic
970319455 4:14861264-14861286 AGACTGACAAAAGTTTACAAAGG - Intergenic
970381546 4:15512954-15512976 AAAAAAAAAAAAGGTTAAAATGG + Intronic
970656901 4:18241354-18241376 AGAGAGAAGAAAGCTGGCAAGGG - Intergenic
970661186 4:18287606-18287628 GGAGAGAAAAATGGTTCCATGGG + Intergenic
970881097 4:20932619-20932641 AGATAGTAAAATGGTTACTATGG - Intronic
970945084 4:21681699-21681721 ACAAAGAAAAAAGGTTTCATTGG + Intronic
971001962 4:22333241-22333263 ATAAAGAAAAAAGGTTTCATTGG - Intergenic
971101652 4:23472854-23472876 AGAGAGGAAAAAAATTACACTGG + Intergenic
971350265 4:25849497-25849519 AGGGAGAAAAGAGGTTACCAGGG + Intronic
971447355 4:26765291-26765313 GGAGAGAAAAAAAGTTTGAAAGG + Intergenic
971581191 4:28343121-28343143 AGAGAGAAATAAGGTAAAGAGGG + Intergenic
971686954 4:29782895-29782917 AGAGAGAAAAATGGAGAAAAAGG + Intergenic
971878834 4:32341205-32341227 AGAGAGAAAAAGGGGGAAAATGG + Intergenic
972179372 4:36444434-36444456 AGAGAGAAAAAAAGAGAAAAAGG + Intergenic
973011720 4:45083461-45083483 AGAAGGAAAAATGGATACAAGGG - Intergenic
973012859 4:45098327-45098349 AGAAAGAAAAAAGTTTAAGAAGG + Intergenic
973367665 4:49220929-49220951 AGAAAGAAAAGAGGTTAAACTGG + Intergenic
973574679 4:52274896-52274918 ATAAAGAAAAAAGGATAAAAAGG + Intergenic
973786123 4:54334482-54334504 AGAGAGAAAAAAGGAAATAGAGG + Intergenic
974164143 4:58178590-58178612 ATAAAGAAAAAAGGTTTCATTGG - Intergenic
974428840 4:61770873-61770895 AGAGAGAAAGAACATTAGAAAGG - Intronic
974459616 4:62170758-62170780 AGAGAGCTAATAGGTTAAAATGG + Intergenic
974544297 4:63280274-63280296 AGAGAAACAAAAATTTACAAAGG + Intergenic
974632050 4:64505248-64505270 AGAGAGAAAAAAAATTATATAGG + Intergenic
974912112 4:68134948-68134970 AGAGAGAAAAAGAGCTAAAATGG + Intergenic
975008026 4:69314561-69314583 AGAGGGAAAAAAGATGAGAATGG + Intronic
975009997 4:69339188-69339210 AGAGGGAAAAAAGATGAGAATGG - Intronic
975351831 4:73355884-73355906 AGAGAGAACAAAGATGACTAAGG - Intergenic
975919454 4:79367086-79367108 AGAGAGAAAAATCTTTATAAAGG + Intergenic
976043074 4:80911281-80911303 TGAGTGAAAAAAGGTAAAAATGG - Intronic
976502549 4:85808366-85808388 AAAGAAAAAAAAGGTTAAAGTGG - Intronic
977022208 4:91772477-91772499 AGAGAGAAAAATGGTTTCATGGG - Intergenic
977141874 4:93383606-93383628 GGAGAGAAACAAGATTAGAAAGG - Intronic
977189353 4:93980302-93980324 AGAGAGAGAAAGGGGTACGATGG + Intergenic
977220589 4:94332979-94333001 GGAGAGAAAAAACGTTTTAAAGG + Intronic
977239463 4:94549274-94549296 ACAGAGAAAAAGGGGTACAGAGG - Intronic
977719315 4:100221452-100221474 AGAGAGAAAGAAAGGAACAAAGG - Intergenic
977729449 4:100333191-100333213 ATAAAGAAAAAAGAATACAAAGG + Intergenic
978028252 4:103905213-103905235 AGAGAGAATAAAGGATTCAGTGG + Intergenic
978115139 4:105010692-105010714 AAAGAAAAAAAAGGTGACAAGGG + Intergenic
978116667 4:105026712-105026734 AGAGAGAGATAAGGGTAGAAAGG + Intergenic
978238209 4:106486247-106486269 ATAAAGAAAAAAGGATAAAAAGG - Intergenic
978249458 4:106612816-106612838 AGATTGACAAAAGGTTTCAAAGG - Intergenic
978308212 4:107355289-107355311 AGAGAAAATAAAGGATAAAAGGG - Intergenic
978420871 4:108531561-108531583 ACAGAGAAGAGAGGCTACAAAGG - Intergenic
978453137 4:108858848-108858870 AGACAAAAAAAAAGTTTCAAAGG + Intronic
978534399 4:109745748-109745770 AAAGATAAAAAGGTTTACAAAGG - Intronic
978983643 4:114982821-114982843 AGAGAGAAAAATGGTTTCTTGGG + Intronic
979420463 4:120498798-120498820 ACAGAGAGAAAAGGGAACAAGGG - Intergenic
979421540 4:120510551-120510573 ATAGAGAAAAAAGAATAAAAAGG + Intergenic
979488517 4:121296992-121297014 ACAGAGTAAAATGGTTACCAAGG + Intergenic
979722579 4:123919325-123919347 AATGAGAAGAAAGATTACAAAGG + Intergenic
979748205 4:124243613-124243635 TGAGAGAAAAATGGTTCCAAGGG + Intergenic
979759816 4:124388479-124388501 AGAAAGAAAAAAAGTTAGCAGGG - Intergenic
979801479 4:124914403-124914425 AGAGTGAAAATAGTATACAATGG - Intergenic
979882928 4:125985849-125985871 AGAGAGAAAAAAGGGTCCTTGGG + Intergenic
980448354 4:132940824-132940846 AGAGAGAAAGAAAGTAACAAAGG + Intergenic
980744518 4:136998214-136998236 ATAGAGAAAAAAGAATAAAAAGG - Intergenic
980858236 4:138466412-138466434 AGAGATAAAAAATGATAAAAAGG - Intergenic
980986230 4:139697295-139697317 GGAGAAAAAAAAAGTCACAAAGG - Intronic
981322667 4:143410883-143410905 GGAAAGAAGAAAGGTTAAAATGG + Intronic
981445083 4:144826834-144826856 AGTCAGAAAAGAGGTTACTATGG + Intergenic
981553813 4:145969778-145969800 AAAGAAAAAAATGGTTAAAATGG + Intergenic
981914602 4:150020375-150020397 AAAGAATAAAAAGGTTAAAAAGG - Intergenic
982213875 4:153063638-153063660 AGAGGGAAAAAAGTTTAAATGGG + Intergenic
982363536 4:154550187-154550209 AGAGAGAAAAGAGGCTACGAGGG - Intronic
982396019 4:154916524-154916546 AGAGATAAAAAAGAAAACAAAGG - Intergenic
982415112 4:155121861-155121883 GGAGAGAAAAAAGGGGACAAAGG + Intergenic
982493609 4:156062336-156062358 AGAGAGGATAAAGGATCCAAAGG + Intergenic
982860253 4:160439444-160439466 AGAGAGAAAAAAAGAAAGAAAGG - Intergenic
983029896 4:162786648-162786670 AGAAAGGAAAAATGTTACACTGG + Intergenic
983046163 4:162989034-162989056 AAAGAAAAAAAAAGCTACAAAGG - Intergenic
983138614 4:164119796-164119818 GCAGAGAAAAAAGCTTAAAATGG + Intronic
983256959 4:165410602-165410624 AAAGAAAAGAAAGGTTACAAAGG + Intronic
983395702 4:167193187-167193209 AGAGAGAAAGAAAGGGACAAAGG - Intronic
983412308 4:167416927-167416949 AGAGATAAAACAGGTTCCAGAGG + Intergenic
983420058 4:167505949-167505971 ATAGAGAAAAAAGAATAAAAGGG - Intergenic
983594546 4:169451225-169451247 AACGAGAAAAAAGGTTAACAAGG + Intronic
983621181 4:169762143-169762165 AAAGATAAAGAAGGTTAAAAAGG - Intergenic
983899085 4:173114036-173114058 ATAGAGAAAAAAGAATGCAAAGG + Intergenic
983911309 4:173242682-173242704 AGAGAGAAAGAAGGGTACTGAGG + Intronic
984097726 4:175452368-175452390 AGAGAGAGAAATTGTTTCAAAGG - Intergenic
984399171 4:179239510-179239532 ACAGAGAAAAAAAGGCACAAAGG + Intergenic
984647809 4:182238343-182238365 AGAGAGAAGAATAATTACAAAGG - Intronic
984931813 4:184854498-184854520 AGAGAGAAAAAAGGGCAAATTGG + Intergenic
985207375 4:187553689-187553711 TGAGAGTAAAAATGTTTCAATGG - Intergenic
985320031 4:188700769-188700791 ATAAAGAAAAGAGGTTACATTGG + Intergenic
985388490 4:189469605-189469627 AGATAGTAAAATGGTTACTATGG + Intergenic
985585024 5:726662-726684 ACACAGAAAAAATGTTAAAAGGG + Intronic
985598528 5:810977-810999 ACACAGAAAAAATGTTAAAAGGG + Intronic
986402012 5:7391999-7392021 AGAGAGAAAAATGAATACACAGG + Intergenic
986413682 5:7507139-7507161 AGAGGTAAAAATGGTAACAAAGG + Intronic
986670276 5:10137511-10137533 AGAGAGAAAATATGTTATAATGG - Intergenic
986767742 5:10942684-10942706 AGAAAGAAAAAAGGAAAAAAAGG - Intergenic
987605842 5:20135038-20135060 AGAGAGAAGAAAGGTGAGACAGG + Intronic
987832078 5:23107313-23107335 AGAGAGAAAGAAAGAAACAAAGG + Intergenic
987909435 5:24122561-24122583 GGAGAGAAAAATGGTTTCATGGG - Intronic
987912923 5:24171851-24171873 AGGGAGAAAAAGTGTTACAACGG + Intronic
987953254 5:24703551-24703573 ACAGAGTAAAAAGGTTACTCTGG - Intergenic
988074401 5:26334346-26334368 AGAGAGAAAGAAGGTGACAGAGG + Intergenic
988296778 5:29374133-29374155 AGAGAGAAATACAGTTAAAAGGG + Intergenic
988372677 5:30391907-30391929 ATAGAGAAAAAATCTTAAAAAGG - Intergenic
988653887 5:33185624-33185646 AGAAATAAAGAAGATTACAAAGG - Intergenic
989290398 5:39758040-39758062 AGAAAAAAAAAAGGTTAACACGG + Intergenic
989348359 5:40454543-40454565 AGAGAGAAAAATGGCTATCAGGG - Intergenic
989392607 5:40917289-40917311 AAAGAGTAAAATGGTTACCAAGG - Intronic
989520300 5:42393098-42393120 GGAGGGAAAAATGGTTTCAAGGG - Intergenic
989736066 5:44708373-44708395 AGAGACAAAAAAGATTATATAGG + Intergenic
990021604 5:51134321-51134343 AGGAAGAAAAAACGTTTCAAGGG + Intergenic
990158085 5:52902549-52902571 AGAGGAAAAAAAGGCTAAAATGG - Intronic
990253110 5:53937236-53937258 TGAGAGATAAAAGGTTATCAGGG + Intronic
990280856 5:54249465-54249487 ACAGAGAAAAAAGTTCAGAAGGG + Intronic
990340730 5:54820410-54820432 ATAGAGAAACAAGGTTACTCAGG + Intergenic
990359977 5:55008413-55008435 ATAGAGAAAAAAGAATAAAAAGG + Intronic
990700543 5:58470583-58470605 AGAGAGAAAAAAGAAAACATTGG - Intergenic
990852906 5:60227505-60227527 AGAGGGAAATAAGGGTAGAAGGG + Intronic
990981610 5:61607059-61607081 AGTGAAAGAAGAGGTTACAATGG + Intergenic
991164393 5:63546566-63546588 AGAAAGAAAAAAGGAAAGAAAGG - Intergenic
991360128 5:65811222-65811244 AGAGAGAATAAAGATAAGAATGG + Intronic
991516154 5:67437812-67437834 ACAGAAAAAAAAGCTTGCAAAGG - Intergenic
992293469 5:75304315-75304337 AGACATAAATAAGGTTATAAAGG + Intergenic
992384071 5:76266790-76266812 AAAAAAAAAAAAGGTTAAAATGG + Intronic
992404629 5:76445455-76445477 AAAAAAAAAAAAGGTTAAAACGG - Intronic
992588262 5:78264358-78264380 ACAGAGAGAAAAGGTTTCAAAGG + Intronic
992753235 5:79880317-79880339 AGAGAGAATACAGGTGAGAAAGG + Intergenic
992753462 5:79882414-79882436 AGAGAGAATACAGGTGAGAAAGG - Intergenic
992915493 5:81448088-81448110 ACAGAGAAACAAGGATAAAATGG - Intronic
993391026 5:87319655-87319677 AGAGGGAAAAATGGTTTCATGGG - Intronic
994019443 5:95005745-95005767 AGAAAGAAAAGAGGTTCCATTGG - Intronic
994062805 5:95499471-95499493 ACAGAGAAAAGAGGTTAAATTGG - Intronic
994088177 5:95782823-95782845 AAAAAAAAAAAAGGTTAAAATGG + Intronic
994204757 5:97022273-97022295 AGAGACAAAATAGATTATAATGG - Intronic
994551263 5:101238247-101238269 AGAGAGAAAAAAGAATGAAAAGG - Intergenic
994565449 5:101440240-101440262 AGAGAAAAAGAAGATTACATAGG + Intergenic
994577504 5:101597239-101597261 AGAGGGAAAGAAGGAAACAAAGG + Intergenic
994591221 5:101775213-101775235 AGAGAGAAAAAAGCATCAAAGGG - Intergenic
994878931 5:105461168-105461190 GGAGAGAAAAATGGTTTCCAGGG - Intergenic
994905777 5:105839578-105839600 GGAGAGAAAAATGGTTTCATGGG - Intergenic
995001207 5:107132232-107132254 AGAGAAAAAAACGGTTATCAGGG - Intergenic
995032171 5:107493267-107493289 AGAGAGAACAAAGGTTTTATTGG - Intronic
995092893 5:108200298-108200320 AGAGAGAAGAAAGGTTCTGAGGG + Intronic
995125527 5:108574094-108574116 AGAGAGTAAAAATGTTACTGGGG + Intergenic
995282510 5:110352084-110352106 AGATAGAAAATAGGTTGCCATGG - Intronic
995533927 5:113116948-113116970 AGAAAAGAAAAAGGTAACAAAGG + Intronic
995599143 5:113776882-113776904 AGAGAGAGAAAGATTTACAAGGG + Intergenic
995666310 5:114545926-114545948 ATAGAGAAAAAAGAATAAAAAGG + Intergenic
995762441 5:115577619-115577641 AGAAAGAATAGAGGTTACCAGGG - Intergenic
995790768 5:115883669-115883691 AAAGAGTAAAAATATTACAAAGG - Intronic
995896106 5:117012792-117012814 ATAGAGAAAAAAGAATAAAAAGG - Intergenic
995908350 5:117154702-117154724 ACAGAGAAAGAAGGTTATATTGG - Intergenic
995944735 5:117630411-117630433 AGAGACTAAAAAGGATACAAAGG - Intergenic
996168765 5:120261962-120261984 AGAGAGGAAAATGGGTATAATGG - Intergenic
996302490 5:122005720-122005742 AGAGAGAAAGAAAGGAACAAAGG - Intronic
996637736 5:125714803-125714825 AAACAGAAAAAAAGTTTCAAGGG + Intergenic
997024456 5:130041879-130041901 ACAGAGAGAAAGGGTAACAATGG + Intronic
997664469 5:135618482-135618504 AGAGAGAAAGAAAGGAACAAAGG - Intergenic
997990055 5:138537206-138537228 AGAGAGAAAAGAGGTAGTAAAGG - Intronic
998033041 5:138889691-138889713 GGAGAGAAGAGAGGTTAGAAAGG - Intronic
998073409 5:139216947-139216969 AGAAAGAAACACGGTTAGAATGG + Intronic
998495816 5:142588409-142588431 AGAAAGAAAAAAGGAAAGAAAGG - Intergenic
999485944 5:151996221-151996243 AGAGAGAAAGAAAGGAACAAAGG - Intergenic
999535516 5:152512381-152512403 GGAGAGGAAAAGGGTTACACTGG + Intergenic
999908201 5:156166972-156166994 AAAGTGAAAAAAGGTCAGAATGG - Intronic
999987518 5:157017850-157017872 AAAGAGAAAATAAGTTAAAAAGG - Intergenic
1000538804 5:162512936-162512958 AGAGAGAAAAAAGGAAAGAAAGG - Intergenic
1000636716 5:163652323-163652345 AGAAATAAAAAGGGTTATAAAGG - Intergenic
1000639911 5:163689103-163689125 AGATAGTAAAATGGTTACAGTGG - Intergenic
1000710890 5:164576399-164576421 AGAGAGAGAAAAGATAATAAGGG - Intergenic
1001574177 5:172751222-172751244 AGAGAGAAAGAAGGAAAGAAAGG + Intergenic
1002982456 6:2153199-2153221 AGATACAACAAAGGTTAAAAAGG + Intronic
1003088423 6:3080496-3080518 TAAGAGAAAAAAGAATACAAGGG - Intronic
1003571613 6:7259889-7259911 AGAGAGAGAAAAGGTAATGAGGG + Intergenic
1003745043 6:8991375-8991397 AGATACTAAAAAGGTTACTAAGG - Intergenic
1003979356 6:11375671-11375693 AGAGAGAGAAAAGGACAGAAGGG - Intronic
1003989083 6:11467962-11467984 AGAGAGAAAGAAGACAACAAGGG - Intergenic
1004144590 6:13053309-13053331 AGAGAAAAAAAGTGTTAAAATGG - Intronic
1004175997 6:13340685-13340707 AGAAAGAAAAGAGTTGACAAGGG + Intergenic
1004408516 6:15358611-15358633 AAAAAGCAAAAAGGTTACAGTGG - Intronic
1004550716 6:16644519-16644541 AAAAAAAAAAAAGGTTAAAATGG + Intronic
1004742759 6:18478025-18478047 AGAGAGCAAAAAGTTTCCATGGG - Intergenic
1005116811 6:22347912-22347934 AGAAAGAAAAAATGTTCCCATGG + Intergenic
1005332607 6:24764345-24764367 AGAGAAAAAAGAGGTAGCAACGG - Intergenic
1005517600 6:26569766-26569788 TGAGACACAAAAGGGTACAATGG - Intergenic
1005648156 6:27862070-27862092 AGACATAAAAAAGGTTTCAGGGG + Intronic
1006044032 6:31279044-31279066 AAAGGAAAAAAAGGGTACAATGG - Intronic
1006218460 6:32466709-32466731 AGACAGAAAGAAGGTTAGAGGGG - Intergenic
1007527230 6:42507172-42507194 AGAAAGAAAAAAGTTCAGAAGGG - Intergenic
1007989370 6:46239342-46239364 AGAGAGAAAAAAGGTTACAAAGG - Intronic
1008144056 6:47868163-47868185 AGTGAGAAAAAATTTTAAAACGG - Intergenic
1008165110 6:48127775-48127797 AGAGAGAAAAACTGAGACAAAGG - Intergenic
1008505026 6:52221605-52221627 AGACAGAAAAAAGGAAAAAAAGG + Intergenic
1008726409 6:54426620-54426642 AAAAAGAAAAAAAGTTAAAAAGG - Intergenic
1008742443 6:54625657-54625679 TGAGAGAAAAAAAGACACAAAGG + Intergenic
1008889229 6:56466395-56466417 TGAAAAAAAAAAGATTACAAAGG + Intronic
1009299870 6:62003605-62003627 AAAGAGACAGAAGGTTAAAAAGG + Intronic
1009573722 6:65424429-65424451 AGAGAGAAAGGAAGTAACAAAGG - Intronic
1009629876 6:66182673-66182695 AAAGAGTTAAAAGGATACAATGG - Intergenic
1009848457 6:69164370-69164392 AGAAAAAAAAAAGCTTACAAAGG + Intronic
1009973239 6:70646689-70646711 AGAGAGAAAGAAGATGACTAGGG + Intergenic
1010257741 6:73778378-73778400 AGAAAGAAAAAATGAAACAAAGG - Intronic
1010270639 6:73912776-73912798 ATAGAGAATAAAAATTACAAAGG + Intergenic
1010555280 6:77271972-77271994 AGAGAGATAAAATATTACATGGG - Intergenic
1010751064 6:79616477-79616499 AGTGAGAAAAATGTGTACAAAGG - Intergenic
1010754201 6:79648222-79648244 AGAGAGAGAAAATGTTGCAAAGG - Intronic
1011044071 6:83062734-83062756 AGACATAAGAAAGGTTAAAAAGG + Intronic
1011278898 6:85657121-85657143 AGAGACAAGAAAGGTTTCAGAGG - Intergenic
1011324507 6:86134908-86134930 AGAGAAAAAGAAAGTAACAAAGG + Intergenic
1011740267 6:90352677-90352699 AGAAAGAATAGAGGTTACCAGGG - Intergenic
1011925459 6:92638753-92638775 ATAGAGAAAAATAGATACAAGGG - Intergenic
1011969462 6:93204296-93204318 AGAGAGAAAGAAGTTTAAACTGG + Intergenic
1012406195 6:98901558-98901580 AGAGAGAAAGAAAGTCAGAAAGG - Intronic
1012428845 6:99142867-99142889 AAAAAAAAAAAAGGTTAAAATGG + Intergenic
1012567267 6:100673917-100673939 AGAGAGAAAAAAGAGAACACAGG - Intronic
1012596974 6:101052853-101052875 TTAGAGAAAAAAGAATACAAAGG - Intergenic
1012777681 6:103519018-103519040 AGGGAGAGAAAAAATTACAAAGG - Intergenic
1012794735 6:103744918-103744940 AGACAGAAAAAATGTCAGAAAGG - Intergenic
1013459253 6:110358978-110359000 AGAGAGAACAGAAGTTACCATGG + Intergenic
1013902236 6:115171160-115171182 AGAAAGAAAAAAGGGAAAAAGGG - Intergenic
1014060076 6:117061789-117061811 AGAGAGAAAGAAAGAAACAAAGG - Intergenic
1014084924 6:117331285-117331307 AGAGAGAAAAAAGAATGAAAAGG + Intronic
1014136485 6:117895680-117895702 AGAGTGAAAAAAGTGTATAAGGG + Intergenic
1014305307 6:119733844-119733866 AGAGAAAACAAAAGGTACAATGG - Intergenic
1014321394 6:119933150-119933172 AGAAAGAAAAAAGAAAACAATGG - Intergenic
1014367405 6:120561902-120561924 ATAGAGAAAAAAGAATAAAAAGG - Intergenic
1014406432 6:121057713-121057735 AGAGACTAGAAAGGTTAGAAGGG + Intergenic
1014711599 6:124812723-124812745 AGAAAAAAAAAAGGTCAAAAGGG - Intronic
1014830354 6:126095971-126095993 AGAAAGAAAAGAGGTAACACTGG + Intergenic
1014918413 6:127182403-127182425 AGATAGAAAAAAGTTTTAAAGGG - Intronic
1014992943 6:128104021-128104043 AGAGAGAAAAGCAGGTACAAAGG - Intronic
1015345740 6:132156053-132156075 AGAAAGAAAGAAGGGTAGAAGGG - Intergenic
1015418058 6:132972583-132972605 AGAGAGAAAAAAGTTCATGATGG + Intergenic
1015426108 6:133069572-133069594 AGAGAGTAGAAAGGTTACCAGGG + Intergenic
1015754542 6:136594308-136594330 TGAGAGAAGAAAGGTTTGAAGGG + Intronic
1016262742 6:142192626-142192648 GGAGAGAGAAAAGGGGACAAGGG - Intronic
1016521051 6:144947248-144947270 AGAGAGAAAAACAAGTACAAAGG - Intergenic
1016847818 6:148586598-148586620 ATAGAGAAAAAAGAATAAAAAGG - Intergenic
1017756068 6:157530655-157530677 GAAAAGAAAAAAGGCTACAAAGG - Intronic
1017857895 6:158367127-158367149 AGAAAGAAAAGAGGTGACAGTGG - Intronic
1017943126 6:159070868-159070890 AAAAAAAAAAAAAGTTACAAGGG - Intergenic
1018087186 6:160313438-160313460 AAAAAGAAAAAAGGATAAAAAGG - Intergenic
1018141230 6:160838888-160838910 AGAGAGAAAACATGTTCCAGGGG - Intergenic
1018239960 6:161763920-161763942 AGGGAGGAAAATGGTTGCAAAGG - Intronic
1018448502 6:163881712-163881734 AGAGACCAAAAATGATACAAAGG + Intergenic
1018516986 6:164593244-164593266 AGAGAGAACAAACTTCACAATGG + Intergenic
1018543414 6:164909103-164909125 AGAAAGAAAAAAGGAGAAAATGG + Intergenic
1019303300 7:320285-320307 AGAGAGATACTAGGATACAAAGG + Intergenic
1019699065 7:2464259-2464281 AAAAAAAAAAAAGGTTAAAATGG - Intergenic
1019741154 7:2674928-2674950 AGAGAGAAAGAATATTTCAAAGG - Intergenic
1019795113 7:3043409-3043431 AGGGAGAAAAAGGGTTGGAAGGG + Intronic
1019905419 7:4059007-4059029 AGAGAGAAAGAAGGGAACAAAGG + Intronic
1020131597 7:5561956-5561978 AAAAAAAAAAAATGTTACAATGG + Intronic
1020262581 7:6538912-6538934 AGAGAGAAGAAAGGAAAGAAAGG + Intronic
1020542027 7:9470400-9470422 GGAGGGAAAAATGGTTTCAAGGG + Intergenic
1021515516 7:21480534-21480556 AGAAACAAAAAGGATTACAAAGG - Intronic
1021720360 7:23498981-23499003 AAAGAAAAAAAAAGTCACAATGG - Intergenic
1021925920 7:25533553-25533575 AGAGATAGAACAGGTTACGAGGG - Intergenic
1022182700 7:27937757-27937779 AGATAGAAAACAGGTTTAAATGG - Intronic
1022950811 7:35336330-35336352 AGAAAGAAAAATGGTTAAGATGG + Intergenic
1023409310 7:39873145-39873167 TGAGAGAAAAACGGTTTGAATGG - Intergenic
1023646524 7:42322828-42322850 AGAGGGAAAAATGATTAAAAAGG - Intergenic
1024271329 7:47644464-47644486 AGAGAGAAAGAAAGAAACAAAGG + Intergenic
1024427106 7:49239082-49239104 ATAGAGAAAAAAGAATAAAAAGG - Intergenic
1024719296 7:52117224-52117246 TGAGAGAATAAAGGTGAAAAGGG + Intergenic
1024763312 7:52627390-52627412 GGAGAGAATAAAGGTTAGCAAGG + Intergenic
1025043624 7:55670885-55670907 TGAGAGAAAAACGGTTTGAACGG + Intergenic
1025136544 7:56419390-56419412 TGAGAGAAAAATGGTTTGAACGG + Intergenic
1025163462 7:56687198-56687220 GGACAGAAAAAAAGTTATAATGG - Intergenic
1025612453 7:63088122-63088144 GGACAGAAAAAAAGTTATAATGG - Intergenic
1025707147 7:63876434-63876456 GGACAGAAAAAAAGTTATAATGG + Intergenic
1026213672 7:68329223-68329245 AGAGAGAAAAAGGGGAATAAAGG - Intergenic
1026226229 7:68443874-68443896 ACAGAGAAAAGAGGTTAAATTGG - Intergenic
1026999566 7:74643044-74643066 AAAAAAAAAAAAGGTTAAAATGG + Intergenic
1027534589 7:79381250-79381272 ATAGAGAAGAAAGATTATAAAGG - Intronic
1027991387 7:85366536-85366558 AGAGAGAAAAAATAATATAAAGG - Intergenic
1028141226 7:87277020-87277042 AGACAGAAAGAAGGTAGCAAAGG - Intergenic
1028407209 7:90488403-90488425 TAAGAAAAAAAAGTTTACAAGGG + Intronic
1029629063 7:101739245-101739267 AAAAAGAAAAAAGGTTACTCTGG + Intergenic
1030807465 7:113935408-113935430 ATAGAGAAAAAAGAATAAAAAGG - Intronic
1031098280 7:117447312-117447334 AGAGAGAGTAGAGGTTACCAAGG - Intergenic
1031626981 7:124003346-124003368 ATAAAGAAAAAATGTTAAAAAGG - Intergenic
1031676983 7:124622596-124622618 AGAGAGAAAAATAGTAAGAAAGG + Intergenic
1031732770 7:125319133-125319155 AGAGAGAACAGTGGTTACCAGGG + Intergenic
1031754727 7:125624467-125624489 AGAGAGAAAAAGGGAGAGAAAGG - Intergenic
1032120688 7:129153557-129153579 AAACAAAAAAAAGGTTACAAAGG + Intronic
1032422782 7:131796308-131796330 AGATATAAAAAAGGCCACAAAGG + Intergenic
1032720316 7:134546259-134546281 AAAGAGAAAAAAGGAGAAAAAGG - Intergenic
1033666899 7:143450033-143450055 AGAGAGAAAAAAAGGAAGAAAGG - Intergenic
1033929060 7:146501519-146501541 ACAAATAAAAAAGCTTACAAAGG - Intronic
1033976482 7:147108873-147108895 TGAGAGAAAGAAGATTACATAGG + Intronic
1034042614 7:147895311-147895333 AGAAAGAAAATAGGCTAGAAAGG - Intronic
1034121658 7:148633442-148633464 AGAAGGAAGAAAGGTTAGAATGG + Intergenic
1034872469 7:154696315-154696337 AGGGAGAGGAAAGGTTACACGGG + Intronic
1035671181 8:1418463-1418485 AGAGAGAAAGAAGTTAACGATGG - Intergenic
1036014780 8:4770686-4770708 AGAGTACAAAAAGGATACAATGG + Intronic
1036455043 8:8899075-8899097 AGAAAGGAAAAAGTTTCCAAAGG - Intergenic
1036511978 8:9408966-9408988 AGAAAAAAAAAAGGTCATAAAGG + Intergenic
1036630673 8:10512299-10512321 AGAGAGAATCAAGGTTTCCAAGG - Intergenic
1036740628 8:11358244-11358266 AGAGAGAAAAGAAGTTTAAAAGG - Intergenic
1036913630 8:12783330-12783352 AGTGAGGAAAAAGGCCACAAAGG - Intergenic
1037090663 8:14913080-14913102 AGAAAGAAAAAAATTTAAAAAGG + Intronic
1037142118 8:15532546-15532568 AGAGAGTAAGAAGTTTAAAAAGG + Intronic
1037370378 8:18170870-18170892 AGAGAGAGAAAAAGGAACAAAGG - Intronic
1037385310 8:18333551-18333573 AGAGAGAAAAATGTCTACAAAGG + Intergenic
1038237989 8:25780248-25780270 AAAGAGAATAAAGGTAAAAATGG - Intergenic
1038251011 8:25904240-25904262 AAAAAAAAAAAAGGTTAAAAAGG + Intronic
1038682390 8:29681052-29681074 AGATAGAAAACAATTTACAAAGG + Intergenic
1038693260 8:29782363-29782385 AGAGAGAAAAAAAGTTCCCTAGG + Intergenic
1038817197 8:30916705-30916727 AGAAAGAAAAGAGATTAAAATGG - Intergenic
1038972414 8:32650670-32650692 AAAAAAAAAAAAGCTTACAAAGG + Intronic
1038978312 8:32726233-32726255 AGAGAGAAAAATCTTGACAATGG - Intronic
1039438735 8:37579864-37579886 AGAGAGAGAAAAGGGTAGGAAGG - Intergenic
1039779027 8:40765561-40765583 GCAGAGAAAAAAGGTTTCCACGG + Intronic
1040042859 8:42934167-42934189 AGAGAGAAAAAACGAGAGAAAGG - Intronic
1040846283 8:51844923-51844945 AAAGAGAAAAAGTGTTAAAAAGG - Intronic
1040924346 8:52661723-52661745 TGAGAAAAAAAATGTTTCAAAGG + Intronic
1041350204 8:56940830-56940852 AGAGTAAAAAAAGTTTATAAGGG - Intergenic
1041568828 8:59312668-59312690 AGAGAGCAGAGAGGTGACAAGGG - Intergenic
1041615451 8:59900695-59900717 ATAGAGAAAAAAGAATAAAAAGG + Intergenic
1041773567 8:61498908-61498930 TGAGAGACAAAAGGTTTAAAAGG + Intronic
1041981957 8:63872656-63872678 AGAGAAAAAGAAGATTCCAAAGG + Intergenic
1042323332 8:67502044-67502066 AGATATAAAAAAGGTTAATAAGG - Intronic
1042345847 8:67727269-67727291 AATGAGAAAATAGGATACAAAGG - Intronic
1042911281 8:73829349-73829371 AGAGAGGAAAAAGATTAAAATGG + Intronic
1043101831 8:76057201-76057223 AGAGAGAAATAAAGGAACAAAGG + Intergenic
1043222964 8:77689623-77689645 AGAGAAAAAATAGGTTAAAAAGG + Intergenic
1043264572 8:78248077-78248099 AGAGAGGAAAAAGTATATAATGG + Intergenic
1043291196 8:78603637-78603659 AGTGAGAAAAGAGGTTCCTAGGG + Exonic
1043648337 8:82553239-82553261 AGAGAGGAAAAGGGTAATAAGGG - Intergenic
1043752550 8:83957519-83957541 GGAGAGAAAGAAGGGTTCAATGG - Intergenic
1044095465 8:88058545-88058567 AGAAAGAAAAAAGGATATTAAGG + Intronic
1044113434 8:88304240-88304262 AGAGAGAAAAAAGAATGAAAAGG + Intronic
1044326747 8:90867869-90867891 AGACAGAAAAAGGGTGAGAAAGG - Intronic
1044956793 8:97489736-97489758 AGACAGAAAAAAGATTACTCAGG + Intergenic
1044981894 8:97724296-97724318 AAAGAGAAAAATGGGTAAAATGG - Intronic
1045037316 8:98185706-98185728 AGAGAGATATAAAGGTACAAGGG - Intergenic
1045351781 8:101347818-101347840 AAGGAGAAAAGAGGTTGCAATGG - Intergenic
1045798301 8:106071905-106071927 AGGGGGAAAAAAGGTTCAAAGGG + Intergenic
1046240342 8:111482560-111482582 AAAAAAAAAAAAGGTTAAAATGG - Intergenic
1046510163 8:115191955-115191977 AGAAAAAAAAAAGGAAACAAAGG + Intergenic
1046723658 8:117651410-117651432 AGAGAGAAAAAAAGAGAGAAGGG + Intergenic
1046765236 8:118062021-118062043 AGAGAGAAAATGGCTTGCAATGG + Intronic
1046770906 8:118115352-118115374 AGAAAGACAAAAGATAACAATGG + Intergenic
1046895292 8:119464956-119464978 ATAGAGAAAAAAGAATAAAAAGG + Intergenic
1046942125 8:119941386-119941408 AAAAAAAAAAAAGGTTAGAATGG + Intronic
1047070910 8:121342468-121342490 AGAGAAAAAATAGGCTAGAAAGG - Intergenic
1047503034 8:125456836-125456858 AGAAAAAAAAAAGGTTAAGATGG - Intergenic
1047505827 8:125479234-125479256 AGAGAGGAAGAAACTTACAAAGG - Intergenic
1047710435 8:127546406-127546428 AGAGTGATAAAAGGTTGCCAGGG - Intergenic
1048063402 8:130943843-130943865 ACAGAGTAAAATGGTCACAAGGG + Intronic
1048210237 8:132448933-132448955 AGAGAGAAAAAAGGCCAACACGG + Intronic
1048412430 8:134189228-134189250 AGAGAGAAAAAAAATGAGAAAGG - Intergenic
1049076957 8:140405346-140405368 AGAGAGAAAAAAGGCTCTCATGG - Intronic
1049290905 8:141801315-141801337 GCAGAGAACAAAAGTTACAAAGG - Intergenic
1050075643 9:1860185-1860207 AGAGAGGAAAAAAGAAACAAAGG + Intergenic
1050425010 9:5503558-5503580 ACAGAGAAAAAAGAATAAAAAGG + Intergenic
1050794884 9:9525804-9525826 AAAAAAAAAAAAGTTTACAAAGG - Intronic
1051533628 9:18132693-18132715 AGGGGGGAAAAAGGGTACAATGG - Intergenic
1051613984 9:18990040-18990062 AGAGAGAACAGATGTTCCAAAGG + Intronic
1051878811 9:21818931-21818953 AAAGAGTAGAAAGGTTACCAGGG - Intronic
1051914069 9:22186487-22186509 AGAGAGAAAAAATAATAAAAAGG + Intergenic
1052090494 9:24320995-24321017 AGGGAGAAAAATGGTTTCATGGG - Intergenic
1052095056 9:24373700-24373722 AGAGAGACAAATGGTTGCAATGG + Intergenic
1052161950 9:25273140-25273162 ACAAAGAAAAAAGGTTTCATTGG - Intergenic
1052270652 9:26625100-26625122 AGAAAAAAAAAAAGTTAAAAAGG + Intergenic
1052367945 9:27634336-27634358 GAAGAGAACAAAAGTTACAAAGG + Intergenic
1052409416 9:28104007-28104029 ATAGAAAAAAGAGGTTACAGTGG - Intronic
1052424554 9:28287663-28287685 AGAGAGAAAAAAGTCTCAAAAGG + Intronic
1053032568 9:34793891-34793913 AGAGAGAAAAAAAATAACAGGGG - Intergenic
1053125825 9:35580259-35580281 AGAGAGAAAAATGGTTTCATGGG + Intergenic
1053146986 9:35718555-35718577 AGAGAGAGAAAAGATGACAAGGG + Intronic
1054971165 9:71088897-71088919 AGAGGGAGAAAAGGGTATAATGG + Intronic
1054988426 9:71290884-71290906 AAAGAGAAAAAAGTTGAAAAAGG + Intronic
1055064573 9:72105614-72105636 AAAAAAAAAAAAGATTACAATGG + Intergenic
1055272098 9:74572666-74572688 AGAAAGAAAAAATATTCCAAGGG - Intronic
1055425211 9:76188414-76188436 GGAGAAAAAAAAGGGTACACGGG + Intronic
1055636758 9:78286783-78286805 AGAGAGAAGCAAAGTTAGAAAGG + Intergenic
1056010728 9:82327158-82327180 ATAGAGAAAAAAGAGTAAAAAGG - Intergenic
1056114595 9:83429717-83429739 AGAGAGAAAAATTGTTAAGAAGG - Intronic
1056258125 9:84821086-84821108 AAAAAGAAAACAGGTTACAAGGG - Intronic
1056325491 9:85475083-85475105 AGAGGGAAAAATGGTTTCATGGG + Intergenic
1056480656 9:87001019-87001041 AGAGAAAAAAATGGATACAAAGG - Intergenic
1056523372 9:87420555-87420577 AGAGAGAGAAGAGGGAACAAGGG + Intergenic
1056648856 9:88440572-88440594 AGAAAAAAAAAAGGGTAGAAAGG - Intronic
1056656739 9:88515726-88515748 AGAAAGAAAAACTGCTACAATGG + Intergenic
1057639686 9:96806591-96806613 AGAGAATAAAATGGTTACCAGGG + Intergenic
1057967345 9:99517208-99517230 AAAGAAAAAAGAGGTTACAGTGG - Intergenic
1058124929 9:101180438-101180460 AGAGAAAAAAAAGAATAAAACGG + Intronic
1058253025 9:102725825-102725847 AGAGAAATAAAAGGGAACAAAGG - Intergenic
1058388293 9:104464159-104464181 ATAAAGAAAAGAGGTTACATTGG + Intergenic
1058470330 9:105271357-105271379 AGGGGGAAAAAAAGATACAAGGG - Intronic
1058530220 9:105899111-105899133 ATAGAGAAAAAAGAATAAAAAGG - Intergenic
1058825808 9:108774996-108775018 ACAGAGAAGAAAGGATACAGAGG - Intergenic
1059556870 9:115290085-115290107 ATAGAGAAAAAAGGATGAAAAGG + Intronic
1059645270 9:116259781-116259803 TGAGGGAAAAAAGGCTAAAATGG - Intronic
1059817585 9:117935000-117935022 AGAGAGCAAAATGGATAGAAAGG - Intergenic
1059899950 9:118912933-118912955 AGAGAGAAAAACTGATTCAAAGG - Intergenic
1060261433 9:122078218-122078240 AAATAGAAAAAAAGATACAATGG + Intronic
1061234975 9:129336984-129337006 AGAGAGAAAAGAAATTACAAAGG - Intergenic
1061368267 9:130183686-130183708 AGAGAGAAAAAAAGAAAGAAAGG - Intronic
1061571735 9:131482014-131482036 AAAGAGAAAAGGGGTAACAAGGG + Intronic
1061650440 9:132044091-132044113 AAAGAGAAAAAAAGTCACAGAGG + Intronic
1062476710 9:136731488-136731510 AAAAAAAAAAAAGGTTAAAACGG + Intergenic
1185556202 X:1023139-1023161 AAAGAGAAAAAAAGTTTCCAAGG + Intergenic
1185695613 X:2192126-2192148 AAAAAAAAAAAAAGTTACAATGG + Intergenic
1185742598 X:2545894-2545916 ATAGAGAAAAAAGGTTTAATTGG + Intergenic
1185807853 X:3077041-3077063 AAAGAAAAAAAAAGATACAAAGG + Intronic
1185881016 X:3740842-3740864 AGAGAAAAAAAAAGAAACAAAGG + Intergenic
1185986462 X:4840252-4840274 AGAGATAACAAATGTTACAGAGG - Intergenic
1186703427 X:12116253-12116275 AGAGAGAGAGAAGGTTGAAAGGG - Intergenic
1186934980 X:14439490-14439512 AGAGAGAAACAAAGAAACAAAGG + Intergenic
1186975292 X:14896039-14896061 TGAGAAAAAAAAGGTTGAAAAGG - Intronic
1187027615 X:15452338-15452360 ACAGGGAGAAAAGGTTAAAATGG - Intronic
1187315188 X:18186500-18186522 AGAGAAACAAAAAGTTAAAAAGG + Intronic
1187339480 X:18408503-18408525 TGATAGATACAAGGTTACAAAGG - Intergenic
1187434817 X:19258266-19258288 AAAGAGAAAAAAGAATTCAAGGG + Intergenic
1187513070 X:19939895-19939917 AGAAAGAATAGAGGTTACCAGGG + Intronic
1187586456 X:20667941-20667963 AGAGAGAAATAAAGTAACATAGG - Intergenic
1187615810 X:20991969-20991991 AGAGGGAAAAATGGTTTCATGGG - Intergenic
1187880499 X:23842648-23842670 AGAGAAAAAAAGGCTTATAAGGG + Intronic
1187961456 X:24570196-24570218 AAAAAAAAAAAAGGTTAAAATGG + Intronic
1188117664 X:26264580-26264602 AAAGAAAGAAAAGGTAACAAAGG + Intergenic
1188273389 X:28171644-28171666 AGAGACAGACAAGGTGACAAGGG - Intergenic
1188279783 X:28251708-28251730 AGAGAGAAAAAATTGTAAAATGG + Intergenic
1188312628 X:28636509-28636531 AGAGAGAGAAAAGGTTTTATGGG - Intronic
1188372810 X:29389363-29389385 AAAAAAAAAAAAGGTTAAAACGG + Intronic
1188665298 X:32812288-32812310 AAACAAAAAAAAAGTTACAAAGG + Intronic
1188694370 X:33171773-33171795 AGAGAGCAAAATGGTTAAGAAGG + Intronic
1189261953 X:39685711-39685733 AGAAAGAAAAGAAGTAACAAGGG + Intergenic
1189449684 X:41117552-41117574 AGAAAAAAAAAAGGTTAGAATGG - Intronic
1189463406 X:41260370-41260392 ATACATAAAAATGGTTACAATGG - Intergenic
1189479356 X:41381017-41381039 AGAGAGAAAAGAGGCCACAAGGG - Intergenic
1189508259 X:41634967-41634989 AGTGAGAAGAAAGGCTAAAATGG + Intronic
1189557959 X:42164924-42164946 ATAGAGAAAAAAGAATAAAAAGG - Intergenic
1190100215 X:47517070-47517092 AGGTTGAAAAATGGTTACAATGG + Intergenic
1190129333 X:47732689-47732711 AGGGAGAAAAATGACTACAAGGG + Intergenic
1190196230 X:48320975-48320997 AGAGAGAAAAGAGAATGCAATGG - Intergenic
1190219971 X:48505779-48505801 AAAAAGAAAAAAAATTACAAAGG + Intergenic
1190308199 X:49098506-49098528 AGAAAAAAAAAAGGTAATAAAGG + Intronic
1190382320 X:49851845-49851867 AGGGAGAGAAAAGGATACACAGG - Intergenic
1190513533 X:51198677-51198699 AGAAAGAAAGAAAGTAACAAAGG - Intergenic
1190662941 X:52671351-52671373 AGAGAGAAAAGAGAATGCAATGG - Intronic
1190676482 X:52787131-52787153 AGAGAGAAAAGAGAATGCAATGG + Intronic
1190783711 X:53623260-53623282 AGAAAGAGAAAAGGATACACAGG - Intronic
1190870401 X:54420279-54420301 ACAGAAAAAAATGGTTAAAATGG - Intergenic
1191068650 X:56377673-56377695 AGAAAGAAAAAAGGAGTCAAAGG - Intergenic
1191632215 X:63333836-63333858 AAAGAGACAAAAGGTTAATAAGG + Intergenic
1191640190 X:63423391-63423413 AGAGAGGAAATAGGAAACAAAGG - Intergenic
1191664218 X:63681864-63681886 AGAGATGAAAAGGATTACAAGGG + Intronic
1192093289 X:68183474-68183496 AGGGAGAACAAAGGTTAAAAAGG + Intronic
1192244230 X:69359787-69359809 AGAGAGAAAGAAGAATACAGTGG - Intergenic
1192613682 X:72594459-72594481 AGAAAGAAAAAGGATTATAAGGG + Intronic
1192723611 X:73725209-73725231 AGAGGGAAAAATGGTTTCATGGG - Intergenic
1192769503 X:74172576-74172598 AGAGAGAAAAAAAGGAACAAAGG + Intergenic
1193113613 X:77755032-77755054 TTAGAGAAAAAAGGTTGAAAAGG - Intronic
1193266312 X:79474246-79474268 ATCGAGAAAAAAGGCAACAAAGG + Intergenic
1193500440 X:82267406-82267428 AGAGAGAACTAAGTTTACTATGG + Intergenic
1193719360 X:84970357-84970379 ATAGAGAAAAAAGAATAAAAAGG - Intergenic
1193729769 X:85088965-85088987 AGAGAGAAAAAATAGTTCAAGGG - Intronic
1193762731 X:85487968-85487990 ATAGAGAAAAAAGAATAAAAAGG - Intergenic
1193820135 X:86150765-86150787 ACAAACTAAAAAGGTTACAAGGG + Intronic
1193880596 X:86916486-86916508 AGAGAGAAAAAAGATTAAAAAGG + Intergenic
1194079020 X:89434739-89434761 ACACAGAAAAAAGGAAACAATGG - Intergenic
1194208718 X:91042469-91042491 TGAGACAAAAAACATTACAAAGG + Intergenic
1194458372 X:94133337-94133359 AGAGAGTAAAAAGGTTACTACGG + Intergenic
1194563142 X:95447577-95447599 GGAGAGAAAAATGGTTTCATGGG - Intergenic
1195026879 X:100886239-100886261 AGAGAGAAAAAAGGCAACTGTGG + Intergenic
1195616360 X:106915710-106915732 AGAGAGAATAAAGGTTTGAGAGG - Intronic
1195769643 X:108336848-108336870 AGAGTGTTAAATGGTTACAAAGG - Intronic
1196271206 X:113713359-113713381 AGACAGAAAAACTGTTAGAAAGG - Intergenic
1196274167 X:113747393-113747415 AGAGAATTAAAAAGTTACAAAGG - Intergenic
1196627274 X:117890835-117890857 AGAGATAAAAAAGGTTTCCAAGG - Intergenic
1196665278 X:118309491-118309513 AGAGATTAAAAATGGTACAATGG - Intergenic
1196687609 X:118525492-118525514 AAATAGAATAAAGGTTACCAGGG + Intronic
1196770070 X:119284478-119284500 AGAGAGTAAATGGGTGACAAAGG + Intergenic
1196948599 X:120853189-120853211 AGGGACAAAAATGGTTAAAATGG + Intergenic
1197016600 X:121632809-121632831 AGAGAGAAAAATGGTTTCGTGGG - Intergenic
1197187173 X:123600588-123600610 ATTTAGAAAAAAGGTTACACTGG + Exonic
1197897392 X:131330011-131330033 AGAGAGAATAATGGTCAAAAGGG + Intronic
1198512732 X:137370272-137370294 AGAGAGATAAGATGTTTCAAAGG - Intergenic
1198519784 X:137441206-137441228 AAAGCGAACAAAGGTTCCAAGGG + Intergenic
1198792542 X:140361352-140361374 AGAGAGAAAAAGAGAGACAATGG - Intergenic
1199034673 X:143035719-143035741 ATAAAGTAAAATGGTTACAATGG + Intergenic
1199120633 X:144049142-144049164 ATAGAGAAAAAAGAATAAAAAGG + Intergenic
1199206984 X:145160280-145160302 GGAGAGAAAAATGGTTTCATAGG - Intergenic
1199401764 X:147406672-147406694 AGACACAACAAAGGTTACAAAGG + Intergenic
1199870452 X:151893785-151893807 AGTGAGAGAAAAGGTCACAGAGG - Intergenic
1200130020 X:153836810-153836832 ATACTGAAAAATGGTTACAATGG - Intergenic
1200356999 X:155562387-155562409 AGAAAAAAAAAAGGTTTCATGGG - Intronic
1200431352 Y:3086733-3086755 ACACAGAAAAAAGGAAACAATGG + Intergenic
1200431642 Y:3090057-3090079 ACACAGAAAAAAGGAAACAATGG - Intergenic
1201229206 Y:11846773-11846795 ATAGAGAAAAAAGAATAAAAAGG + Intergenic
1201493227 Y:14565464-14565486 TTAGAGAAAAAAGGATAAAAAGG + Intronic
1201799824 Y:17942993-17943015 AGAGAGAATAAAGGGAACCAAGG + Intergenic
1201801729 Y:17962963-17962985 AGAGAGAATAAAGGGAACCAAGG - Intergenic
1202361710 Y:24117604-24117626 AGAGAGAAAAAAGGGAACCAAGG - Intergenic
1202363363 Y:24135492-24135514 AGAGAGAAAAAAGGGAACCAAGG + Intergenic
1202507417 Y:25534625-25534647 AGAGAGAAAAAAGGGAACCAAGG - Intergenic
1202508264 Y:25544400-25544422 AGGGAAAAAAAAGCTAACAATGG - Intergenic
1202509068 Y:25552509-25552531 AGAGAGAAAAAAGGGAACCAAGG + Intergenic