ID: 1007989371

View in Genome Browser
Species Human (GRCh38)
Location 6:46239351-46239373
Sequence AAAAGAATCAGAGAGAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4439
Summary {0: 1, 1: 2, 2: 20, 3: 455, 4: 3961}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007989371_1007989376 27 Left 1007989371 6:46239351-46239373 CCTTTTTTCTCTCTGATTCTTTT 0: 1
1: 2
2: 20
3: 455
4: 3961
Right 1007989376 6:46239401-46239423 TGGTGGATCCCAGAGAAAAGTGG No data
1007989371_1007989373 7 Left 1007989371 6:46239351-46239373 CCTTTTTTCTCTCTGATTCTTTT 0: 1
1: 2
2: 20
3: 455
4: 3961
Right 1007989373 6:46239381-46239403 CATGAGCTCCTATTGAACTTTGG 0: 1
1: 0
2: 1
3: 6
4: 110
1007989371_1007989374 10 Left 1007989371 6:46239351-46239373 CCTTTTTTCTCTCTGATTCTTTT 0: 1
1: 2
2: 20
3: 455
4: 3961
Right 1007989374 6:46239384-46239406 GAGCTCCTATTGAACTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007989371 Original CRISPR AAAAGAATCAGAGAGAAAAA AGG (reversed) Intronic
Too many off-targets to display for this crispr