ID: 1007989373

View in Genome Browser
Species Human (GRCh38)
Location 6:46239381-46239403
Sequence CATGAGCTCCTATTGAACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007989371_1007989373 7 Left 1007989371 6:46239351-46239373 CCTTTTTTCTCTCTGATTCTTTT 0: 1
1: 2
2: 20
3: 455
4: 3961
Right 1007989373 6:46239381-46239403 CATGAGCTCCTATTGAACTTTGG 0: 1
1: 0
2: 1
3: 6
4: 110
1007989369_1007989373 30 Left 1007989369 6:46239328-46239350 CCAGGGAATTCAGTCCTTTGTAA 0: 1
1: 0
2: 2
3: 11
4: 158
Right 1007989373 6:46239381-46239403 CATGAGCTCCTATTGAACTTTGG 0: 1
1: 0
2: 1
3: 6
4: 110
1007989370_1007989373 16 Left 1007989370 6:46239342-46239364 CCTTTGTAACCTTTTTTCTCTCT 0: 1
1: 1
2: 4
3: 88
4: 1149
Right 1007989373 6:46239381-46239403 CATGAGCTCCTATTGAACTTTGG 0: 1
1: 0
2: 1
3: 6
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007989373 Original CRISPR CATGAGCTCCTATTGAACTT TGG Intronic
900519707 1:3099666-3099688 CATGAGCTCATTAGGAACTTGGG + Intronic
901498217 1:9634961-9634983 GATGAGGTCACATTGAACTTGGG + Intergenic
903176275 1:21583351-21583373 CAGCAGCTTCTGTTGAACTTTGG + Intergenic
904300064 1:29548577-29548599 CATGAGCTCCCATTGATTTCTGG + Intergenic
904405250 1:30284077-30284099 CATGAGCTCCCATTGATTTCTGG - Intergenic
906760883 1:48377247-48377269 CATTTGCTCCCATTGTACTTAGG + Intronic
916649233 1:166819521-166819543 CTTGTGCTCCTATTGAATCTTGG - Intergenic
918954869 1:191193804-191193826 TATGAGCTCCTTTTCAATTTTGG - Intergenic
921193472 1:212730155-212730177 CATGAGAACCTCTTGAACCTGGG + Intronic
921218581 1:212957370-212957392 CATGAGCTCATAATGAATTAAGG + Intronic
922584978 1:226727224-226727246 CACCAGCTCCTATTCAACTGGGG + Intronic
924097480 1:240568014-240568036 CATGAGAACCACTTGAACTTGGG + Intronic
1066395694 10:35019291-35019313 CATGATCTCCTAATGCTCTTTGG - Intronic
1067781119 10:49208302-49208324 CATGAGCTCTAATTAAAGTTGGG + Intergenic
1069619451 10:69827659-69827681 TATGAGCTGCTATTTACCTTTGG + Intronic
1071418246 10:85461651-85461673 CATTTGCTCCCACTGAACTTAGG - Intergenic
1071430817 10:85605177-85605199 TATGAGCTCCTGTTAAACTGTGG + Intronic
1071875094 10:89836706-89836728 CAGCATCTCCTCTTGAACTTAGG - Intergenic
1074459295 10:113622454-113622476 CATGAGCAGCAATTGTACTTTGG - Intronic
1077701591 11:4447052-4447074 CATGGGCTACCATTGTACTTAGG - Intergenic
1083926646 11:65811297-65811319 AATGAGCTCCCACTGGACTTTGG + Intergenic
1085109931 11:73878722-73878744 TATGGGATCCTATTCAACTTTGG + Intronic
1088007917 11:104964742-104964764 CATGAGCTCCAAGTTATCTTGGG + Intronic
1088017271 11:105076186-105076208 CAGGAGCTCCAATTTATCTTGGG + Intronic
1094024002 12:25943063-25943085 CATGGGCTCCTCTTCACCTTTGG - Intergenic
1095987558 12:48009757-48009779 CTTGAACTCCTATTGCATTTGGG + Intergenic
1096434177 12:51574462-51574484 CATGAGAATCTCTTGAACTTGGG - Intergenic
1096958296 12:55549477-55549499 CATTAGCCCCTTTTGAACGTGGG + Intergenic
1097251551 12:57635590-57635612 CATGAGAACCACTTGAACTTGGG + Intergenic
1098417233 12:70248172-70248194 CATGAGCTCATATTAGATTTGGG + Intronic
1100041387 12:90322668-90322690 CAGGAGCTGCTATTTAGCTTTGG + Intergenic
1105683867 13:22758023-22758045 CATGAACTCCAATTCAACATTGG - Intergenic
1109787400 13:67196780-67196802 CAAGAGCTCCTATTTGGCTTAGG - Intronic
1117532844 14:56675966-56675988 CATGTGGACCTATGGAACTTTGG - Intronic
1121831891 14:97059894-97059916 CATGAAATGCTATTGTACTTTGG + Intergenic
1122457897 14:101869413-101869435 CATAAGCTTTTATTTAACTTGGG + Intronic
1127198128 15:56612758-56612780 CATAAGCTCCGATTTACCTTTGG - Intergenic
1129772577 15:78212361-78212383 CATGAGCTCTCATGGATCTTTGG + Intronic
1130709969 15:86270363-86270385 CATTTGCTCCTATGGGACTTAGG - Intronic
1131725158 15:95213998-95214020 CAGGAGATTCTATTGAACCTGGG + Intergenic
1131783610 15:95886945-95886967 CATGATATCCTGTTGAACTTTGG + Intergenic
1133482141 16:6181234-6181256 CATGAGCTCCTTTTGGACCATGG + Intronic
1136853193 16:33630579-33630601 CATGAGCACTGCTTGAACTTGGG + Intergenic
1137901982 16:52278569-52278591 TATGAGCTCCTATTTATCATGGG + Intergenic
1141668991 16:85481677-85481699 CAGCAGCTCCTTTTGACCTTGGG + Intergenic
1143597963 17:7926878-7926900 CATGAGCTCCTAAAGCACTGTGG - Intronic
1153951242 18:10059604-10059626 CATGGGCTCCTGTTTTACTTAGG + Intergenic
1157107874 18:44791915-44791937 CATGACCTCCTACTCAACTGTGG + Intronic
1158236078 18:55315542-55315564 CATGAACTCCACTTAAACTTTGG - Intronic
927381096 2:22479952-22479974 CATGAGCTCATCTTCAATTTAGG + Intergenic
928722728 2:34139144-34139166 CATCAGCACTTATTTAACTTAGG + Intergenic
930613960 2:53574192-53574214 AATGAGGTCCTATTGAATTAGGG - Intronic
930771969 2:55138064-55138086 CATGAGCTCCTCTGCACCTTGGG + Intergenic
931847282 2:66217640-66217662 CATGGCTTCCTATTGCACTTAGG - Intergenic
933385211 2:81602039-81602061 CATGAGAACCGCTTGAACTTGGG - Intergenic
933938591 2:87226952-87226974 CATGAGCTCCCATTGTTCTTGGG + Intergenic
936354544 2:111738822-111738844 CATGAGCTCCCATTGTTCTTGGG - Intergenic
940486286 2:154300014-154300036 AAAGAGCTGCTATTGGACTTGGG - Intronic
941719490 2:168798356-168798378 CATGAGCTTCTATTACATTTGGG + Intronic
942286553 2:174423560-174423582 CATGAGAATCTCTTGAACTTGGG - Intronic
943968691 2:194374241-194374263 GATGAGCTCCTCTTCAACTGAGG + Intergenic
944064631 2:195605826-195605848 CATGAGCTCATATTTCCCTTAGG - Intronic
944392472 2:199231028-199231050 CATGAGCATCATTTGAACTTGGG + Intergenic
947450621 2:230205054-230205076 CATGGCCTCCTATTGCCCTTAGG - Intronic
1169962761 20:11180235-11180257 AATGAACTCATATTGAATTTTGG - Intergenic
1174800540 20:53559789-53559811 CATGAGAATCAATTGAACTTGGG + Intergenic
1180791842 22:18578848-18578870 CCTGGGCTCCTCTTGGACTTGGG - Intergenic
1181229894 22:21416461-21416483 CCTGGGCTCCTCTTGGACTTGGG + Intergenic
1181248755 22:21518405-21518427 CCTGGGCTCCTCTTGGACTTGGG - Intergenic
1181999281 22:26907027-26907049 CATGAGCTCCTCCTGTTCTTGGG + Intergenic
1183476308 22:38038005-38038027 CATGAGCACCTACTGTGCTTAGG - Intronic
1185182359 22:49370667-49370689 AATGAAATGCTATTGAACTTGGG - Intergenic
949395607 3:3611851-3611873 CATGAGCTCCTAAACAACCTGGG + Intergenic
950211900 3:11129809-11129831 CATGAGAATCTATTGAACCTGGG + Intergenic
967136192 3:186514866-186514888 CATGAGGTCTTTATGAACTTGGG - Intergenic
969686681 4:8679303-8679325 CATGAGCTCCTAATGGCATTTGG + Intergenic
970301708 4:14687958-14687980 CAAGAGCTCCCATTGTAGTTGGG - Intergenic
972753575 4:42019884-42019906 CATGAGAACCACTTGAACTTGGG - Intronic
977322652 4:95538247-95538269 CATCAGCTGCTATTGAAACTGGG + Intronic
983203608 4:164888407-164888429 CATGATATCCTATTTAATTTGGG + Intronic
983319542 4:166178414-166178436 CATGAGGTCCTTCTGTACTTAGG + Intergenic
983933971 4:173485875-173485897 CATGAGCATCTCTTGAACTTGGG + Intergenic
984311297 4:178063495-178063517 CATGAGCTTCTATTCTAATTTGG + Intergenic
987057772 5:14210980-14211002 CATGAGCCCCTAGATAACTTAGG + Intronic
991359355 5:65803370-65803392 CCTCAGCCCCTACTGAACTTTGG - Intronic
991361763 5:65828167-65828189 CATGAGCTGATATTGGAATTTGG - Exonic
995061659 5:107817272-107817294 CATGTGCTCCCATTGAACTTAGG - Intergenic
995320581 5:110829413-110829435 CATGAGCTCCAACTTATCTTGGG + Intergenic
998079807 5:139265537-139265559 CATGAGAATCTCTTGAACTTGGG - Intronic
999931984 5:156443531-156443553 CATGATCATCTATTGAAGTTTGG + Intronic
1000445564 5:161314523-161314545 CTTGTGCTCCTATAGAAATTAGG - Intronic
1000453988 5:161426218-161426240 CAAAAGGTCCTTTTGAACTTTGG + Intronic
1003152054 6:3561080-3561102 CATGAGGACCTTTTAAACTTAGG - Intergenic
1003562570 6:7194718-7194740 TATTACCTCATATTGAACTTGGG + Intronic
1007351975 6:41280670-41280692 GATGAGCTCCACTGGAACTTGGG + Intronic
1007989373 6:46239381-46239403 CATGAGCTCCTATTGAACTTTGG + Intronic
1009985116 6:70772505-70772527 CATGAGCTCCTCTGGTACTCAGG - Intronic
1011938338 6:92811077-92811099 TGTGAACTCCTATTGATCTTGGG - Intergenic
1013330695 6:109096869-109096891 CATGAGATCATATTTAACTACGG - Intronic
1019204147 6:170344832-170344854 AGTGTGCTCCTATTGCACTTGGG + Intronic
1031302257 7:120076334-120076356 CATTAGGTCCTATGGATCTTTGG + Intergenic
1036431047 8:8690871-8690893 CATGAGAACCACTTGAACTTGGG + Intergenic
1037636407 8:20704385-20704407 ATTGAGCTCCTCTTGAAATTTGG - Intergenic
1039860065 8:41449443-41449465 CATTATCTCCTATTCAACTGAGG + Intergenic
1041284927 8:56250789-56250811 CATGAGCTAATATTGAAATGAGG - Intergenic
1041967635 8:63698430-63698452 CATGAGAATCTCTTGAACTTGGG + Intergenic
1044247253 8:89963369-89963391 CATCAGCAGCTATTGAACTTGGG - Intronic
1044911126 8:97060125-97060147 AAGGAGCTATTATTGAACTTGGG + Intronic
1046046814 8:108974541-108974563 AATGGGCTCCTATTGAAGTTAGG + Intergenic
1046798819 8:118402097-118402119 TATGAAAACCTATTGAACTTAGG + Intronic
1048710323 8:137202980-137203002 CATGGGCTCAGATTGAACTGGGG - Intergenic
1052590113 9:30481023-30481045 CATGAGGTCATATATAACTTTGG + Intergenic
1060097304 9:120803358-120803380 CAAGAGGATCTATTGAACTTGGG - Intergenic
1061275403 9:129567181-129567203 TCAGAGCTCCTTTTGAACTTGGG + Intergenic
1188703008 X:33288555-33288577 AATGGCCTCCTATTGACCTTAGG + Intronic
1189123207 X:38417323-38417345 CTTGGGCTCCTAATCAACTTAGG + Intronic
1194017160 X:88637138-88637160 CATGAACTCCCTTTGAACCTTGG - Intergenic
1196158548 X:112457121-112457143 CATGAAATCCCATTGTACTTTGG + Intergenic