ID: 1007989374

View in Genome Browser
Species Human (GRCh38)
Location 6:46239384-46239406
Sequence GAGCTCCTATTGAACTTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007989370_1007989374 19 Left 1007989370 6:46239342-46239364 CCTTTGTAACCTTTTTTCTCTCT 0: 1
1: 1
2: 4
3: 88
4: 1149
Right 1007989374 6:46239384-46239406 GAGCTCCTATTGAACTTTGGTGG No data
1007989371_1007989374 10 Left 1007989371 6:46239351-46239373 CCTTTTTTCTCTCTGATTCTTTT 0: 1
1: 2
2: 20
3: 455
4: 3961
Right 1007989374 6:46239384-46239406 GAGCTCCTATTGAACTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007989374 Original CRISPR GAGCTCCTATTGAACTTTGG TGG Intronic
No off target data available for this crispr