ID: 1007989581

View in Genome Browser
Species Human (GRCh38)
Location 6:46241140-46241162
Sequence TGGTAAAATAGAGACGCACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 50}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007989581_1007989587 20 Left 1007989581 6:46241140-46241162 CCACGTGCGTCTCTATTTTACCA 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1007989587 6:46241183-46241205 ATAAGCTATTTTGCCAGGCTGGG No data
1007989581_1007989586 19 Left 1007989581 6:46241140-46241162 CCACGTGCGTCTCTATTTTACCA 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1007989586 6:46241182-46241204 GATAAGCTATTTTGCCAGGCTGG 0: 1
1: 0
2: 0
3: 10
4: 175
1007989581_1007989583 -5 Left 1007989581 6:46241140-46241162 CCACGTGCGTCTCTATTTTACCA 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1007989583 6:46241158-46241180 TACCATTTTCTGCTGATTGGTGG 0: 1
1: 0
2: 0
3: 15
4: 147
1007989581_1007989585 15 Left 1007989581 6:46241140-46241162 CCACGTGCGTCTCTATTTTACCA 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1007989585 6:46241178-46241200 TGGAGATAAGCTATTTTGCCAGG 0: 1
1: 0
2: 2
3: 55
4: 578
1007989581_1007989582 -8 Left 1007989581 6:46241140-46241162 CCACGTGCGTCTCTATTTTACCA 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1007989582 6:46241155-46241177 TTTTACCATTTTCTGCTGATTGG 0: 1
1: 0
2: 3
3: 40
4: 358

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007989581 Original CRISPR TGGTAAAATAGAGACGCACG TGG (reversed) Intronic
901473212 1:9472007-9472029 TGGTAAAATAAATACGCAAGAGG + Intergenic
901473309 1:9472557-9472579 TGGTAAAATAAATAAGCAAGAGG - Intergenic
902772398 1:18652898-18652920 TGGGAAAACAGATACCCACGGGG - Intronic
904510288 1:30999822-30999844 TAGTAATAAAGAGACGCACTGGG + Intronic
908067044 1:60417233-60417255 TGGTAAGTTTGAGACACACGTGG + Intergenic
917603236 1:176598556-176598578 AGGAAAAATAGAGACTCAAGGGG - Intronic
920310483 1:205045364-205045386 TGTTCAAATAGAGACACATGTGG + Intronic
924874351 1:248084623-248084645 TGGAAAAATAGAGAAGGAAGAGG + Intronic
924890577 1:248273841-248273863 TGGAAAAATAGAGAAGGAAGAGG + Intergenic
1070360525 10:75684204-75684226 TGGTAAAATAGATTCACATGAGG + Intronic
1076444364 10:130501852-130501874 TGGTAAAATAAAGAGCCACAGGG + Intergenic
1078894008 11:15582101-15582123 TGATAAAATGGAGACGCATCTGG + Intergenic
1080229007 11:29995787-29995809 AGGTAGAATAAAGACGCACAGGG + Intergenic
1082858356 11:57829540-57829562 TGGTAAAATAGGCAATCACGAGG - Intergenic
1084468675 11:69342520-69342542 TGGTCACAGAGAGAGGCACGGGG + Intronic
1090391371 11:126390666-126390688 TGGTAAAATGCACAAGCACGAGG + Intronic
1101159851 12:101962382-101962404 TGGTGAAATAGAGACACAGAGGG + Intronic
1111907646 13:94273560-94273582 TTGTAAAATGGTGAAGCACGTGG + Intronic
1115880494 14:37911592-37911614 TGGTAAAATAGGGTTGCAGGAGG + Intronic
1121448195 14:93991664-93991686 TGCTAAAATAGAGCCACACAGGG + Intergenic
1147459354 17:40558405-40558427 TGGTGAAATAGAGACCCATCCGG - Intronic
1150652515 17:67019237-67019259 TGGTGAAATAGAACAGCACGCGG + Intronic
1154225869 18:12503412-12503434 TGGCAAAATAAAGACGGACAAGG - Intronic
1158342658 18:56483591-56483613 TGGAAAAATAGAAATGCACTAGG + Intergenic
1162717754 19:12644558-12644580 TGTTAAAACAGGGACGCATGTGG + Intronic
929972284 2:46592780-46592802 AGGTAATATACAGACGCACTAGG + Intronic
932124211 2:69128675-69128697 GGGCAAAATAGAGATGCAGGTGG + Intronic
935388112 2:102522469-102522491 AGGCAAAATAGAGAAGCACGTGG + Intronic
948581402 2:238989374-238989396 TGGGAAAAGAGAGAAGCAAGTGG + Intergenic
1181081811 22:20420552-20420574 TGGTAAATAAGAGACTCATGTGG + Intergenic
951074715 3:18376034-18376056 TGCTGAAATAGAGACCCATGAGG + Intronic
951764876 3:26186559-26186581 TGATAAAAGAGAGACTCAGGAGG - Intergenic
953386439 3:42508895-42508917 GGGTAAAAAAGAGACACAGGGGG - Intronic
967928487 3:194672313-194672335 TGGTAAAATCGAGACGTAAAAGG - Exonic
974235373 4:59174019-59174041 TGGTAAAATAGAGAGGTAAAAGG - Intergenic
977076665 4:92460989-92461011 TGGTAAAATAGATACATATGAGG - Intronic
978996582 4:115163283-115163305 TGTTAAAATAAAGAAGCACAGGG + Intergenic
981182157 4:141758452-141758474 TAGTAAAATAGAGAGACATGAGG - Intergenic
983706923 4:170672840-170672862 AGGTAAAATAGAGACATATGAGG - Intergenic
991474714 5:67006901-67006923 TGGCAAAATAGAGAGGGAAGGGG + Intronic
1004254481 6:14050436-14050458 TGGTAAAGTGGAGAAGCACAGGG - Intergenic
1005784153 6:29225685-29225707 GGGAAAAAAAGAGACCCACGGGG + Intergenic
1006183527 6:32167768-32167790 TGGTAAAGTGGAGAGGCATGAGG - Intronic
1007989581 6:46241140-46241162 TGGTAAAATAGAGACGCACGTGG - Intronic
1022463427 7:30633833-30633855 TGGTAAAAAAGAGACAATCGAGG + Exonic
1029034505 7:97504556-97504578 TGGGAAAATACAGAGGCAGGGGG - Intergenic
1036007811 8:4686914-4686936 TGGAAGAATGGAGACGCACTTGG + Intronic
1039736794 8:40341262-40341284 TGGTAAAAGGGAGAAGCACTGGG - Intergenic
1048845082 8:138598228-138598250 TGGAGAAAGAGAGACGCAGGGGG + Intronic
1057277266 9:93682591-93682613 CAGTAAAATAGAGACGCTCAGGG - Intergenic
1185908871 X:3964091-3964113 AGGTAAAATAAAAATGCACGTGG + Intergenic
1193327555 X:80197885-80197907 TGGTAAAATAGAGAAGAAAGAGG + Intergenic
1195288060 X:103404800-103404822 TTTTAAAATAGAGACCAACGTGG + Intergenic
1200047958 X:153412598-153412620 TGGTAAAAGAGCGAGGCATGTGG + Intergenic