ID: 1007989584

View in Genome Browser
Species Human (GRCh38)
Location 6:46241160-46241182
Sequence CTCCACCAATCAGCAGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1066
Summary {0: 1, 1: 0, 2: 1, 3: 47, 4: 1017}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007989584_1007989586 -1 Left 1007989584 6:46241160-46241182 CCATTTTCTGCTGATTGGTGGAG 0: 1
1: 0
2: 1
3: 47
4: 1017
Right 1007989586 6:46241182-46241204 GATAAGCTATTTTGCCAGGCTGG 0: 1
1: 0
2: 0
3: 10
4: 175
1007989584_1007989585 -5 Left 1007989584 6:46241160-46241182 CCATTTTCTGCTGATTGGTGGAG 0: 1
1: 0
2: 1
3: 47
4: 1017
Right 1007989585 6:46241178-46241200 TGGAGATAAGCTATTTTGCCAGG 0: 1
1: 0
2: 2
3: 55
4: 578
1007989584_1007989587 0 Left 1007989584 6:46241160-46241182 CCATTTTCTGCTGATTGGTGGAG 0: 1
1: 0
2: 1
3: 47
4: 1017
Right 1007989587 6:46241183-46241205 ATAAGCTATTTTGCCAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007989584 Original CRISPR CTCCACCAATCAGCAGAAAA TGG (reversed) Intronic
901045862 1:6395374-6395396 CTCTACCAATCAGCAGGATGTGG - Intergenic
901601351 1:10426008-10426030 CTCTACCAATCAGCAGGACGTGG - Intergenic
901783465 1:11609437-11609459 CTCTACCAATCAGCAGGATGTGG + Intergenic
902100280 1:13982602-13982624 CTCTACCAATCAGCAGGATGTGG - Intergenic
902814771 1:18909999-18910021 CTCCCCATTTCAGCAGAAAATGG + Intronic
904856287 1:33500355-33500377 TTCCTCCAAGCAGCATAAAATGG - Intergenic
905186017 1:36197383-36197405 CTCTACCAATCAGCAGGATGTGG + Intergenic
905375750 1:37518973-37518995 CTCTACCAATCAGCAGGATGTGG + Intergenic
905685615 1:39905440-39905462 CTTCACAAAGCAGCAGGAAAGGG + Intergenic
906563368 1:46777948-46777970 CTCTACCAATCAGCAGGATGTGG - Intronic
906714789 1:47959815-47959837 CTACTCCAATCAATAGAAAAAGG + Intronic
907759388 1:57343048-57343070 CTCTACCAATCAGCAGGATGTGG - Intronic
907889634 1:58624350-58624372 CTCTACCAATCAGCAGGATGTGG + Intergenic
908151542 1:61307503-61307525 CACCACCCAACACCAGAAAATGG + Intronic
908291469 1:62670771-62670793 CTCTACCAATCAGCAGGATGTGG + Intronic
909376960 1:74951687-74951709 CTCTACCAATCAGCAGGATGTGG - Intergenic
909904447 1:81178246-81178268 CTCTACCAATCAGCAGGATGTGG - Intergenic
910034644 1:82776380-82776402 CTCTACCAATCAGCAGGATGTGG - Intergenic
910609612 1:89127479-89127501 CTCTACCAATCAGCAGGATGTGG - Intronic
911206058 1:95092417-95092439 CTCTACCAATCAGCAGGATGTGG + Intergenic
911259464 1:95669198-95669220 CTCTACCAATCAGCAGGACGTGG - Intergenic
911305096 1:96223817-96223839 CTCTACCAATCAGCAGGATGTGG - Intergenic
911839108 1:102659450-102659472 CTCTACCAATCAGCAGGATGTGG - Intergenic
911954356 1:104216804-104216826 CTCTACCAATCAGCAGGATGTGG - Intergenic
912057979 1:105630595-105630617 CTCTACCAATCAGCAGGATGTGG - Intergenic
912166307 1:107045687-107045709 CTCTACCAATCAGCAGGATGTGG + Intergenic
912316046 1:108668237-108668259 CTCTACCAATCAGCAGGATGTGG + Intergenic
912753743 1:112307224-112307246 CTCCACCATTCTGCAGTACAGGG + Intergenic
912819253 1:112854112-112854134 CTCTACCAATCAGCAGGACGTGG - Intergenic
913141469 1:115945440-115945462 TTCCACCAACCTGCAGAGAAGGG + Intergenic
913160930 1:116146033-116146055 CTCTACCAATCAGCAGGATGTGG - Intergenic
913691950 1:121288103-121288125 CTCTACCAATCAGCAGGATGTGG - Intronic
914145597 1:144991851-144991873 CTCTACCAATCAGCAGGATGTGG + Intronic
914438310 1:147680314-147680336 CTCTACCAATCAGCAGGATGTGG - Intergenic
914928179 1:151906899-151906921 CTCTACCAATCAGCAGGATGTGG + Intronic
915260190 1:154671524-154671546 CTCTACCAATCAGCAGGATGTGG + Intergenic
915261362 1:154678828-154678850 CTCTACCAATCAGCAGGATGTGG + Intergenic
915581840 1:156817498-156817520 TTCCATCATTCAGCAGATAATGG + Intronic
915764369 1:158348587-158348609 CTCTACCAATCAGCAGGATGTGG - Intergenic
915865419 1:159494136-159494158 CTCTACCAATCAGCAGGACGTGG - Intergenic
916909957 1:169336394-169336416 CTCTACCAATCAGCAGGATGTGG - Intronic
916939143 1:169661935-169661957 CTCTACCAATCAGCAGGATGTGG + Intergenic
916940201 1:169668933-169668955 CTCTACCAATCAGCAGGATGTGG + Intronic
917445249 1:175101541-175101563 CTCTACCAATCAGCAGGATGTGG - Intronic
917446203 1:175107699-175107721 CTCTACCAATCAGCAGGATGTGG - Intronic
918059137 1:181046587-181046609 CTCTACCAATCAGCAGGATGTGG + Intronic
918250435 1:182698747-182698769 CTCCACCAGTCCTAAGAAAAGGG + Intergenic
918659640 1:187073414-187073436 CTCTACCAATCAGCAGGATGTGG - Intergenic
918691110 1:187480399-187480421 CTTTACCAATCAGCACAAAACGG - Intergenic
918709067 1:187704382-187704404 CTCTACCAATCAGCAGGATGTGG + Intergenic
918720972 1:187851083-187851105 CTCTACCAATCAGCAGGATGTGG + Intergenic
918732182 1:188012933-188012955 CTCTACCAATCAGCAGGATGTGG - Intergenic
918853084 1:189717897-189717919 CTCTACCAATCAGCAGGATGTGG - Intergenic
919092030 1:192987672-192987694 CTCTACCAATCAGCAGGATGTGG + Intergenic
919174591 1:194002560-194002582 CTCTACCAATCAGCAGGATGTGG + Intergenic
919201255 1:194358077-194358099 CTCTACCAATCAGCAGGATGTGG - Intergenic
919250969 1:195055263-195055285 ATGCACCAATCAGCAGGATATGG + Intergenic
919297638 1:195722426-195722448 CTCTACCAATCAGCAGGATGTGG - Intergenic
920479285 1:206306611-206306633 CTCTACCAATCAGCAGGATGTGG - Intronic
920731245 1:208488036-208488058 CTCTACCAATCAGCAGGATGTGG - Intergenic
920883035 1:209898440-209898462 CTCTACCAATCAGCAGGATGTGG - Intergenic
921396257 1:214672745-214672767 CTCTACCAATCAGCAGGATGTGG - Intergenic
921801942 1:219411531-219411553 CTCTACCAATCAGCAGGATGTGG + Intergenic
921897211 1:220413153-220413175 CTCTACCAATCAGCAGGATGTGG + Intergenic
921903716 1:220475316-220475338 CTCTACCAATCAGCAGGATGTGG - Intergenic
921983551 1:221285258-221285280 CTCTACCAATCAGCAGGACGTGG - Intergenic
922306845 1:224352007-224352029 CTCTACCAATCAGCAGGATGTGG - Intergenic
922485570 1:225970735-225970757 CTCTACCAATCAGCAGGATGTGG + Intergenic
922986009 1:229866337-229866359 CTCTACCAATCAGCAGGATGTGG + Intergenic
923573992 1:235141495-235141517 CTCTACCAATCAGCAGGATGTGG + Intronic
923698201 1:236275600-236275622 CCCCACCAATCTGCAGGAAGGGG - Intronic
924117660 1:240763313-240763335 CTCTACCAATCAGCAGGATGTGG + Intergenic
1063318595 10:5032083-5032105 CTCTACCAATCAGCAGGATGTGG - Intronic
1063769819 10:9184069-9184091 CTCTACCAATCAGCAGGATGTGG + Intergenic
1064197922 10:13260486-13260508 CTCTACCAATCAGCAGGATGTGG + Intergenic
1064790265 10:18951087-18951109 CTCTACCAATCAGCAGGATGTGG - Intergenic
1065743179 10:28815482-28815504 CTCTACCAATCAGCAGGATGTGG - Intergenic
1065752021 10:28896214-28896236 CTCTACCAATCAGCAGGATGTGG - Intergenic
1065802751 10:29367192-29367214 CTCTACCAATCAGCAGGATGTGG + Intergenic
1066050578 10:31631856-31631878 CTCCACCGTTCAGCAGTAATAGG + Intergenic
1066186436 10:33014171-33014193 CTCTACCAATCAGCAGGATGTGG + Intergenic
1066190402 10:33050107-33050129 CTCTACCAATCAGCAGGATGTGG + Intergenic
1066235332 10:33480067-33480089 CTCTACCAATCAGCAGGATGTGG - Intergenic
1066409458 10:35152358-35152380 CTCAATCCATCAGCAGAACAGGG - Intronic
1066567267 10:36734098-36734120 CTCTACCAATCAGCAGGATGTGG - Intergenic
1067363310 10:45601453-45601475 CTCTACCAATCAGCAGGATGTGG + Intergenic
1068374161 10:56156005-56156027 CTCTACCAATCAGCAGGACGTGG + Intergenic
1068460481 10:57322188-57322210 CTCTACCAATCAGCAGGATGTGG + Intergenic
1068845289 10:61664806-61664828 CACCCCCAATCAGCACAAATGGG - Intronic
1068902256 10:62281337-62281359 CTCTACCAATCAGCAGGATGTGG + Intergenic
1068978277 10:63034470-63034492 CTCTACCAATCAGCAGGATGTGG + Intergenic
1069624932 10:69861700-69861722 CACTATCAATCAGCAGAAATTGG - Intronic
1069766270 10:70862423-70862445 CTCTACCAATCAGCAGGATGTGG + Intronic
1069993099 10:72326716-72326738 CTCTACCAATCAGCAGGATGTGG + Intergenic
1070281404 10:75051481-75051503 CTCCACCTATCTCCACAAAAAGG + Intronic
1070719071 10:78744056-78744078 CTACACAAATCTGCAGAGAATGG - Intergenic
1070968430 10:80543976-80543998 CTCTACCAATCAGCAGGATGTGG + Intronic
1071003894 10:80860211-80860233 CTCTACCAATCAGCAGGATGTGG + Intergenic
1071037321 10:81264154-81264176 CTCTACCAATCAGCAGGATGTGG - Intergenic
1071040952 10:81308554-81308576 CTCTACCAATCAGCAGGATGTGG - Intergenic
1071388127 10:85142162-85142184 CTCTACCAATCAGCAGGATGTGG + Intergenic
1071900887 10:90119428-90119450 CTCTACCAATCAGCAGGATGTGG - Intergenic
1072191954 10:93083201-93083223 TTCTACTAAACAGCAGAAAATGG + Intergenic
1073808512 10:107126608-107126630 CTCCACAAATATGCAGAGAAAGG - Intronic
1074175038 10:110990603-110990625 CTCTACCAATCAGCAGGACGTGG + Intronic
1074599130 10:114896042-114896064 CTGAGCCAACCAGCAGAAAAAGG + Intronic
1074999367 10:118783743-118783765 CTCTACCAATCAGCAGGATGTGG + Intergenic
1075255745 10:120924584-120924606 CTCTACCAATCAGCAAAATGTGG + Intergenic
1075269216 10:121034541-121034563 CTCTACCAATCAGCAGGATGTGG - Intergenic
1075307746 10:121382881-121382903 CTCTACCAATCAGCAGGATGTGG + Intergenic
1075537393 10:123282952-123282974 CTCTACCAATCAGCAGGATGTGG - Intergenic
1076250741 10:128982210-128982232 TTCCACCTATCAGCAAGAAAGGG + Intergenic
1076261466 10:129070344-129070366 CTCTACCAATCAGCAGGACGTGG - Intergenic
1076773712 10:132681206-132681228 CTCTACCAATCAGCAGGACGTGG + Intronic
1076796411 10:132800546-132800568 CTCTACCAATCAGCAGGACGTGG - Intergenic
1077675201 11:4188781-4188803 CTTCACCACTCTGTAGAAAAAGG + Intergenic
1077778059 11:5293723-5293745 CTCTACCAATCAGCAGGATGTGG - Intronic
1077805889 11:5590637-5590659 CTCTACCAATCAGCAGGATGTGG + Intronic
1078251768 11:9622514-9622536 CTCTACCAATCAGCAGGATGTGG - Intergenic
1078743560 11:14090847-14090869 CTCTACCAATCAGCAGGATGTGG - Intronic
1078795945 11:14591783-14591805 CTCTACCAATCAGCAGGATGTGG + Intronic
1079567620 11:21902100-21902122 CTCCTCCAATCAGCAGGTAGTGG + Intergenic
1079726102 11:23883070-23883092 CTCTACCAATCAGCAGGATGTGG - Intergenic
1079729752 11:23925147-23925169 CACCTCCACTCAGCAGAGAATGG + Intergenic
1079730452 11:23934289-23934311 CTCTACCAATCAGCAGGACGTGG - Intergenic
1079731629 11:23941874-23941896 CTCTACCAATCAGCAGGACATGG - Intergenic
1079767648 11:24415599-24415621 CTCTACCAATCAGCAGGATGTGG - Intergenic
1080119401 11:28659329-28659351 ATCCAGCAAACAGCAGAACAGGG + Intergenic
1080195080 11:29599787-29599809 CTCTACCAATCAGCAGGATGTGG - Intergenic
1080557569 11:33431341-33431363 CTCTACCAATCAGCAGGATGTGG - Intergenic
1080621589 11:33991099-33991121 CTCTACCAATCAGCAGGATGTGG + Intergenic
1081329578 11:41787704-41787726 CTCTACCAATCAGCAGGATGTGG - Intergenic
1081421054 11:42874912-42874934 CTGTACCAATCAGCAGGAAGTGG + Intergenic
1081422236 11:42882542-42882564 CTCTACCAATCAGCAGGACGTGG + Intergenic
1081428531 11:42950809-42950831 CTCTACCAATCAGCAGGACGTGG + Intergenic
1082698626 11:56401450-56401472 CTCTACCAATCAGCAGGATGTGG - Intergenic
1083546246 11:63551085-63551107 CTCTACCAATCAGCAGGATGGGG + Intergenic
1084107545 11:66989670-66989692 CTCTACCAATCAGCAGGATGTGG + Intergenic
1084210603 11:67619918-67619940 CTCTACCAATCAGCAGGACGTGG + Intergenic
1084211616 11:67626660-67626682 CTCTACCAATCAGCAGGATGTGG + Intergenic
1084406054 11:68974333-68974355 CTCTACCAATCAGCAGGATGTGG - Intergenic
1085245724 11:75098920-75098942 CTCTACCAATCAGCAGGATGTGG + Intergenic
1085341639 11:75735257-75735279 TTCCACCATTCAGTAGACAAGGG - Intergenic
1085447111 11:76608388-76608410 CTCTACCAATCAGCAGGATGTGG - Intergenic
1085670955 11:78464415-78464437 CTCTACCAATCAGCAGGATGTGG - Intronic
1086043163 11:82502039-82502061 CTCTACCAATCAGCAGGATGTGG + Intergenic
1086289705 11:85293259-85293281 CCCCACCAATTAGAACAAAATGG + Intronic
1087441083 11:98184922-98184944 ATGAACCAATCAGCAGAAAGTGG - Intergenic
1087486243 11:98762845-98762867 CTCTACCAATCAGCAGGATGTGG - Intergenic
1087805349 11:102549321-102549343 CTCTGCCAACCAGCAGTAAAGGG - Intergenic
1088020469 11:105112150-105112172 CTCACCCAGTCAGCAGGAAAGGG - Intergenic
1088395081 11:109358700-109358722 CATCACCAATCATCAGAGAAAGG - Intergenic
1088943857 11:114489312-114489334 CTATTCCAATCAGTAGAAAACGG + Intergenic
1088948212 11:114536885-114536907 CTATTCCAATCAGTAGAAAACGG + Intronic
1089061985 11:115633331-115633353 CTCTACCAATCAGCAGGATGTGG - Intergenic
1089252541 11:117175299-117175321 CTGCAGCAGTCAGCAAAAAAAGG - Intronic
1089466279 11:118688574-118688596 CTCTACCAATCAGCAGGATGTGG - Intergenic
1089800366 11:121022421-121022443 CTCTACCAATCAGCAGGATGCGG + Intergenic
1090133440 11:124170319-124170341 CTCTACCAATCAGCAGGATGTGG - Intergenic
1090307547 11:125704224-125704246 CTCTACCAATCAGCAGGATGTGG - Intergenic
1090782836 11:130022367-130022389 CTCTACCAATCAGCAGGACGTGG + Intergenic
1091201338 11:133783165-133783187 CTCTACCAATCAGCAGGATGTGG + Intergenic
1091233327 11:134002527-134002549 CTCTACCAATCAGCAGGATGTGG - Intergenic
1091517032 12:1195145-1195167 CTCAAACAATCAGCTTAAAATGG - Intronic
1092135316 12:6142919-6142941 CTCTACCAATCAGCAGCATGTGG + Intergenic
1092137558 12:6160235-6160257 CTCTACCAATCAGCAGGATGTGG + Intergenic
1092141982 12:6190469-6190491 CTCTACCAATCAGCAGGACGTGG - Intergenic
1092171619 12:6376836-6376858 CTCCACAAGCCAGCAGACAAAGG + Intronic
1092220407 12:6709001-6709023 CTCTACCAATCAGCAGGATGTGG + Intergenic
1092221529 12:6716915-6716937 CTCTACCAATCAGCAGGATGTGG + Intergenic
1092273059 12:7038302-7038324 CTCTACCAATCAGCAGGATGTGG + Intronic
1092336798 12:7640581-7640603 CTCTACCAATCAGCAGGATGTGG + Intergenic
1092350397 12:7751668-7751690 CTCTACCAATCAGCAGGACGTGG - Intergenic
1092364172 12:7862948-7862970 CTCTACCAATCAGCAGGATGTGG + Intronic
1092366661 12:7881988-7882010 CTCTACCAATCAGCAGGATGTGG + Intronic
1092471916 12:8788184-8788206 CTCTACCAATCAGCAGGACGTGG + Intergenic
1092473111 12:8795643-8795665 CTCTACCAATCAGCAGGACGTGG + Intergenic
1092572298 12:9739209-9739231 CTCTACCAATCAGCAGGATGTGG - Intergenic
1092583709 12:9875769-9875791 CTCTACCAATCAGCAGGATGTGG - Intergenic
1092616998 12:10224977-10224999 CTCTACCAATCAGCAGGATGTGG - Intergenic
1092732584 12:11548009-11548031 CTCTACCAATCAGCAGGATGTGG + Intergenic
1092834109 12:12472082-12472104 CTCTACCAATCAGCAGGATGTGG - Intergenic
1093034646 12:14320974-14320996 CTCTACCAATCAGCAGGATTTGG + Intergenic
1093113978 12:15186909-15186931 CTTCACTATTAAGCAGAAAATGG + Intronic
1093189531 12:16058138-16058160 CTCTACCAATCAGCAGGATGTGG + Intergenic
1093266402 12:17008386-17008408 CTCTACCAATCAGCAGGATGTGG + Intergenic
1093381661 12:18500694-18500716 CTCTACCAATCAGCAGGATGTGG + Intronic
1093526958 12:20114709-20114731 CTCTACCAATCAGCAGGATGTGG - Intergenic
1093652675 12:21662244-21662266 CTCTACCAATCAGCAGGATGTGG + Intronic
1093768357 12:22991340-22991362 TTCCATCAATCAGTAGAAAGTGG + Intergenic
1093793820 12:23286483-23286505 CTCTACCAATCAGCAGGATGTGG + Intergenic
1093970338 12:25370140-25370162 CTCTACCAATCAGCAGGATGTGG + Intergenic
1093973084 12:25392200-25392222 CTCTACCAATCAGCAGGACGTGG + Intergenic
1094327685 12:29257405-29257427 CTCCACCAATCAGCAGGATGTGG + Intronic
1094409959 12:30157622-30157644 CTCTACCAATCAGCAGGATGTGG + Intergenic
1094448855 12:30562514-30562536 CTCTACCAATCAGCAGGATGTGG + Intergenic
1094589149 12:31805030-31805052 CTCTACCAATCAGCAGGATGTGG - Intergenic
1094661418 12:32473171-32473193 CTCTACCAATCAGCAGGATGTGG + Intronic
1094718073 12:33033529-33033551 CTCTACCAATCAGCAGGATGTGG - Intergenic
1095123230 12:38442870-38442892 CTCTACCAATCAGCAGGATGTGG + Intergenic
1095304254 12:40621324-40621346 CTCTACCAATCAGCAGGATGTGG + Intergenic
1095901686 12:47334258-47334280 CTCTACCAATCAGCAGGATGTGG + Intergenic
1097017797 12:55999756-55999778 CTCTACCAATCAGCAGGATGTGG - Intronic
1098168081 12:67718714-67718736 CTCTACCAATCAGCAGGATATGG - Intergenic
1098588822 12:72186016-72186038 CTCTACCAATCAGCAGGATGTGG + Intronic
1099523782 12:83695536-83695558 CTCTACCAATCAGCAGGATGTGG - Intergenic
1099559506 12:84154762-84154784 CTCTACCAATCAGCAGGATGAGG - Intergenic
1099716069 12:86295643-86295665 CTCTACCAATCAGCAGGATGTGG - Intronic
1100211760 12:92406138-92406160 CTCTACCAATCAGCAGGATGTGG - Intergenic
1100374454 12:94000655-94000677 CTCCTCCAATAGGCAGAGAAAGG - Intergenic
1100521585 12:95380437-95380459 CTCTACCAATCAGCAGGATGTGG + Intronic
1100584873 12:95970284-95970306 CTCTACCAATCAGCAGGATGTGG + Intergenic
1100734510 12:97512433-97512455 CTCTACCAATCAGCAGGATGTGG - Intergenic
1101009121 12:100431060-100431082 CTCTACCAATCAGCAGGATGTGG + Intergenic
1101021758 12:100560220-100560242 CTCTACCAATCAGCAGGATGTGG + Intronic
1101408994 12:104453830-104453852 CTCCAACAAGGTGCAGAAAAGGG + Intergenic
1102387128 12:112519530-112519552 CTCTACCAATCAGCAGGATGTGG - Intergenic
1102652202 12:114449870-114449892 CTCCCCCCATCTGGAGAAAAGGG + Intergenic
1103257228 12:119552242-119552264 CAACATCAATCAACAGAAAACGG + Intergenic
1103564255 12:121807639-121807661 CTCCACCCCTCAGCAGAAGGAGG - Intronic
1103668663 12:122592746-122592768 CTCTACCAATCAGCAGGATGTGG + Intronic
1103783267 12:123413711-123413733 CTCTACCAATCAGCAGGATGTGG - Exonic
1104582772 12:130022934-130022956 CTCTACCAATCAGCAGGATGTGG + Intergenic
1104614385 12:130256178-130256200 CTCTACCAATCAGCAGGATGTGG - Intergenic
1105037884 12:132939633-132939655 CTCTACCAATCAGCAGGATGTGG + Intronic
1105722316 13:23128612-23128634 CTCTACCAATCAGCAGGATGTGG + Intergenic
1105868160 13:24479700-24479722 CTCTACCAATCAGCAGGATGTGG + Intronic
1105876552 13:24560185-24560207 CTCTACCAATCAGCAGGATGTGG - Intergenic
1106600436 13:31182650-31182672 CTCTACCAATCAGCAGGATGTGG - Intergenic
1106616907 13:31338908-31338930 CTCTACCAATCAGCAGGATGTGG - Intergenic
1106643282 13:31608191-31608213 CTCTACCAATCAGCAGGATGTGG - Intergenic
1106811090 13:33359039-33359061 CTCTACCAATCAGCAGGATGTGG + Intergenic
1106933721 13:34695380-34695402 CTCCACCAAGCATCAGACCAAGG + Intergenic
1107259246 13:38471909-38471931 CTCTACCAATCAGCAGGATGTGG - Intergenic
1107590304 13:41897901-41897923 CTCTACCAATCAGCAGGATGTGG - Intronic
1107836236 13:44414287-44414309 CTCTACCAATCAGCAGGATGTGG + Intergenic
1108099050 13:46935575-46935597 CTCTACCAATCAGCAGGATGTGG - Intergenic
1108435467 13:50397350-50397372 CTCTACCAATCAGCAGGATGTGG + Intronic
1108469335 13:50752907-50752929 CTCTACCAATCAGCAGGATGTGG - Intronic
1108849249 13:54707364-54707386 ATGCACCAATCAGCAGGACATGG + Intergenic
1108858809 13:54828858-54828880 CTCTACCAATCAGCAGGATGTGG - Intergenic
1109141179 13:58714958-58714980 CTCTACCAATCAGCAGGATGTGG + Intergenic
1109145517 13:58774045-58774067 CTCTACCAATCAGCAGGATGTGG + Intergenic
1109433996 13:62274466-62274488 ATGGACCAATCAGCAGAACATGG - Intergenic
1109441485 13:62379950-62379972 CTCTACCAATCAGCAGGATGTGG + Intergenic
1109446489 13:62447548-62447570 CTCTACCAATCAGCAGGATGTGG - Intergenic
1109563069 13:64077343-64077365 CTCTACCAATCAGCAGGATGTGG - Intergenic
1109741641 13:66561786-66561808 CTCTACCAATCAGCAGGATGTGG + Intronic
1109745938 13:66622712-66622734 CTCTACCAATCAGCAGGATGTGG + Intronic
1109825166 13:67709708-67709730 CTGCAGCAATCAGCCAAAAATGG + Intergenic
1110369003 13:74719186-74719208 CTCTACCAATCAGCAGGATGTGG + Intergenic
1110417606 13:75269287-75269309 CTCTACCAATCAGCAGGATGTGG + Intergenic
1110792278 13:79599756-79599778 CTCTACCAATCAGCAGGACATGG - Intergenic
1110862254 13:80356285-80356307 CTCTACCAATCAGCAGGACGTGG + Intergenic
1110874238 13:80490206-80490228 CTCTACCAATCAGCAGGATGTGG - Intergenic
1110914067 13:80999469-80999491 CTCTACCAATCAGCAGGATGTGG + Intergenic
1110940164 13:81340369-81340391 CTCTACCAATCAGCAGGATGTGG - Intergenic
1111365108 13:87233717-87233739 CTTCACGAATCACAAGAAAATGG - Intergenic
1111442041 13:88292701-88292723 CTCTACCAATCAGCAGGATGTGG + Intergenic
1111748472 13:92297707-92297729 CTCTACCAATCAGCAGGATGTGG + Intronic
1111841236 13:93453947-93453969 CTCTACCAATCAGCAGGATGTGG - Intronic
1112359001 13:98699479-98699501 ACCCACCACTCAGCAAAAAAGGG - Intronic
1112518765 13:100078276-100078298 CTCTACCAATCAGCAGGATGTGG + Intergenic
1112533049 13:100223688-100223710 CTCTACCAATCAGCAGGATGTGG - Intronic
1112613227 13:100976459-100976481 CTCTACCAATCAGCAGGATGTGG + Intergenic
1112705987 13:102069352-102069374 CTCTACCAATCAGCAGGATGTGG + Intronic
1112724581 13:102288487-102288509 CTCCACAAATAAGCAAAAAGTGG - Intronic
1112842815 13:103600801-103600823 CTCTACCAATCAGCAGGATGTGG + Intergenic
1113059764 13:106309646-106309668 TACCACCAACCACCAGAAAATGG + Intergenic
1113482544 13:110632467-110632489 CTCTACCAATCAGCAGGATGTGG - Intronic
1113538011 13:111083513-111083535 CTCTACCAATCAGCAGGATGTGG - Intergenic
1114155656 14:20099877-20099899 ATGCACCAATCAGCAGGATATGG + Intergenic
1114560185 14:23584362-23584384 CTCTACCAATCAGCAGGATGTGG - Intergenic
1115163311 14:30419871-30419893 CTTCTCCTACCAGCAGAAAAGGG + Intergenic
1116250898 14:42481905-42481927 CTCTACCAATCAGCAGGATGTGG - Intergenic
1116390656 14:44385502-44385524 CTCTACCAATCAGCAGGACCTGG + Intergenic
1116431299 14:44848224-44848246 CACCACCAAACTGCAGAATAGGG + Intergenic
1116452498 14:45081320-45081342 CTCTACCAATCAGCAGGATGTGG + Intergenic
1116624143 14:47243323-47243345 CTCTACCAATCAGCAGGATGTGG + Intronic
1117077993 14:52123005-52123027 CTCTACCAATCAGCAGGATGTGG + Intergenic
1117302659 14:54443974-54443996 CTCTACCAATCAGCAGGACATGG + Intergenic
1117449928 14:55840179-55840201 CTCTACCAATCAGCAGGATGTGG + Intergenic
1117565752 14:56991779-56991801 CTCTACCAATCAGCAGGATGTGG + Intergenic
1117571796 14:57056098-57056120 CTCTACCAATCAGCAGGATGTGG - Intergenic
1118215269 14:63803072-63803094 CTCTACCAATCAGCAGGATGTGG - Intergenic
1118306434 14:64658890-64658912 CTCTACCAATCAGCAGGATGTGG + Intergenic
1119487012 14:74995992-74996014 CTCTACCAATCAGCAGGATGTGG + Intergenic
1119612497 14:76075353-76075375 CTCCTCGAATCAGGGGAAAAGGG - Intronic
1119673320 14:76536348-76536370 CTCTACCAATCAGCAGGATGTGG - Intergenic
1119870576 14:78013500-78013522 CTCTACCAATCAGCAGGATGTGG - Intergenic
1120438966 14:84512390-84512412 CTCTACCAATCAGCAGGATGTGG - Intergenic
1120844277 14:89112360-89112382 CTCTACCAATCAGCAGGACGTGG + Intergenic
1121350543 14:93169762-93169784 CTCTACCAATCAGCAGGATGTGG - Intergenic
1122493312 14:102134886-102134908 CTCTACCAATCAGCAGGATGTGG - Intronic
1123124339 14:105935336-105935358 CTTCAGAAATGAGCAGAAAATGG - Intergenic
1202845705 14_GL000009v2_random:172342-172364 TTCCATCACGCAGCAGAAAAAGG + Intergenic
1202915102 14_GL000194v1_random:162611-162633 TTCCATCACACAGCAGAAAAAGG + Intergenic
1124114709 15:26830617-26830639 CTCTACCAATCAGCAGGATGTGG - Intronic
1124353845 15:28979918-28979940 CTCCACCAATCAGCCGAGGATGG - Intronic
1124573258 15:30884629-30884651 CTCTACCAATCAGCAGGATGCGG + Intergenic
1124708512 15:31985380-31985402 CTCCACTATTCAACAGAAAATGG - Intergenic
1125104686 15:35956763-35956785 CTCTACCAATGAGCACACAATGG + Intergenic
1125112315 15:36047505-36047527 CTCTACCAATCAGCAGGATGTGG + Intergenic
1125480171 15:40074412-40074434 CTCTACCAATCAGCAGGATGTGG - Intergenic
1125914414 15:43473312-43473334 CTCTACCAATCAGCAGGATGTGG - Intronic
1126748054 15:51847015-51847037 CTCCACTAAGAAGAAGAAAAAGG + Intronic
1127194311 15:56567993-56568015 CTCGAGCAATTAGTAGAAAATGG + Intergenic
1127361459 15:58248167-58248189 CTCCACAAAGCAGCACACAATGG + Intronic
1127750343 15:62033440-62033462 CTTCAAAAAGCAGCAGAAAAAGG - Exonic
1127765944 15:62186134-62186156 CTCTACCAATCAGCAGGATGTGG - Intergenic
1128813168 15:70586653-70586675 CTCTACCAATCAGCAGGATGTGG - Intergenic
1129280229 15:74479546-74479568 CTCTACCAATCAGCAGGATGTGG - Intergenic
1129777379 15:78245735-78245757 CTCTACCAATCAGCAGGATGTGG - Intergenic
1129859287 15:78847595-78847617 CTCTACCAATCAGCAGGATGTGG + Intronic
1129997276 15:80017315-80017337 CTCTACCAATCAGCAGGATGTGG + Intergenic
1130133005 15:81159503-81159525 CTCTACCAATCAGCAGGATGTGG + Intergenic
1130177540 15:81590766-81590788 ATGGACCAATCAGCAGAACATGG + Intergenic
1131845985 15:96491430-96491452 CTCTACCAATCAGCAGGATGTGG - Intergenic
1132139415 15:99379075-99379097 CTATTCCAATCAACAGAAAAAGG - Intronic
1132511134 16:342006-342028 CTCTACCAATCAGCAGGATGTGG + Intronic
1132836697 16:1957798-1957820 CTCTACCAATCAGCAGGATGTGG - Intergenic
1133362536 16:5185962-5185984 CTCTACCAATCAGCAGGATGTGG - Intergenic
1135261994 16:20989162-20989184 CTCTACCAATCAGCAGGATGTGG - Intronic
1135280998 16:21153479-21153501 CTCTACCAATCAGCAGGATGTGG + Intronic
1135550997 16:23398262-23398284 CTCCACCACTCAGCAGGCAGGGG + Intronic
1135626431 16:23999089-23999111 CTCCAACCATGAGCAGAAAAAGG - Intronic
1135750947 16:25058582-25058604 CTCTACCAATCAGCAGGATGTGG - Intergenic
1137243861 16:46686785-46686807 CTACATGAATCAGAAGAAAATGG + Intronic
1138693503 16:58790536-58790558 CTCTACCAATCAGCAGGATGTGG - Intergenic
1139125398 16:64071766-64071788 CTCTACCAATCAGCAGGATGTGG - Intergenic
1139603170 16:67998977-67998999 CTCTACCAATCAGCAGGATGTGG + Intronic
1140722394 16:77783982-77784004 CTCTACCAATCAGCAGGATGTGG - Intergenic
1141046829 16:80723016-80723038 CTTCACCCTGCAGCAGAAAAGGG - Intronic
1142318000 16:89361252-89361274 CTGCCCCAAGCAGCAGGAAACGG + Intronic
1144467275 17:15506479-15506501 CTCTACCAATCAGCAGGATGTGG + Intronic
1144616828 17:16783768-16783790 CTCCTCCAGTCAGGAGAAATGGG + Intronic
1144723342 17:17487232-17487254 CTCTACCAATCAGCAGGATGTGG + Intronic
1144895863 17:18531906-18531928 CTCCTCCAGTCAGGAGAAATGGG - Intergenic
1145136354 17:20412326-20412348 CTCCTCCAGTCAGGAGAAATGGG + Intergenic
1146740349 17:35278643-35278665 CTCTACCAATCAGCAGGATGTGG - Intergenic
1147373831 17:40012272-40012294 CTCTACCAATCAGCAGGATGTGG + Intergenic
1148016994 17:44528735-44528757 CTCTACCAATCAGCAGGACATGG + Intergenic
1148366055 17:47056884-47056906 CTCTACCAATCAGCAGGATGTGG - Intergenic
1148725834 17:49789223-49789245 CTCGACCAATCAGGAGAGGAGGG - Intronic
1149299653 17:55293389-55293411 CTTCACCAGCCAGCAGATAAAGG - Intronic
1150231346 17:63552975-63552997 CTCCACCTATCAGTAGATCAGGG + Intronic
1150598819 17:66632028-66632050 CTCTACCAATCTGCAGAAGAAGG - Intronic
1150625540 17:66838847-66838869 CTGCACCAAACAGAAGAACAAGG - Intronic
1150778413 17:68100160-68100182 CTCTACCAATCAGCAGGATGAGG + Intergenic
1150786643 17:68168839-68168861 CTCTACCAATCAGCAGGACGTGG - Intergenic
1150804508 17:68308679-68308701 CTCTACCAATCAGCAGGATGTGG - Intronic
1152046886 17:77942699-77942721 CTCAGCCAAGCAGGAGAAAATGG - Intergenic
1152618924 17:81351632-81351654 CTCTACCAATCAGCAGGATGTGG - Intergenic
1153643917 18:7178145-7178167 CTCTACCAATCAGCAGGATGTGG - Intergenic
1153832342 18:8935034-8935056 CTCTACCAATCAGCAGGATGTGG - Intergenic
1154128641 18:11716544-11716566 CTCTACCAATCAGCAGGATGTGG - Intronic
1154976357 18:21461177-21461199 CTCCACTGATCAGCAGGGAAGGG - Intronic
1155207906 18:23576995-23577017 CTCTACCAATCAGCAGGATGTGG - Intronic
1155271816 18:24148991-24149013 CTCTACCAATCAGCAGGATGTGG - Intronic
1155521383 18:26672368-26672390 CTCCAGGAATAAGAAGAAAATGG - Intergenic
1155772991 18:29724239-29724261 CTCTACCAATCAGCAGGATGTGG + Intergenic
1155849184 18:30749419-30749441 CTTCACAAAGCAGCAGGAAAGGG - Intergenic
1155852407 18:30789327-30789349 CTCTACCAATCAGCAGGATGTGG + Intergenic
1155856260 18:30838797-30838819 CTCTACCAATCAGCAGGATGTGG - Intergenic
1155976891 18:32140573-32140595 CTCTACCAATCAGCAGGATGTGG + Intronic
1156119349 18:33822976-33822998 CTGCAACAATAATCAGAAAATGG - Intergenic
1156764479 18:40635054-40635076 GTCAACCAATCAGCAGGACATGG - Intergenic
1156863789 18:41866639-41866661 CTCTACCAATCAGCAGGATGTGG + Intergenic
1156943296 18:42795991-42796013 CTCTACCAATCAGCAGGATGTGG + Intronic
1157086106 18:44581656-44581678 CTCTACCAATCAGCAGGATGTGG + Intergenic
1157979668 18:52366423-52366445 CTCTACCAATCAGCAGGATGTGG - Intronic
1158352048 18:56573061-56573083 CTCTACCAATCAGCAGGATGTGG + Intergenic
1158697131 18:59713621-59713643 CTCTACCAATCAGCAGGATGTGG - Intergenic
1158705635 18:59790094-59790116 CTCTACCAATCAGCAGGATGTGG - Intergenic
1159167831 18:64725237-64725259 CTCTACCAATCAGCAGGAGGTGG - Intergenic
1159230935 18:65606009-65606031 CTCTACCAATCAGCAGGATGTGG + Intergenic
1159472802 18:68879433-68879455 CTCTACCAATCAGCAGAATGTGG - Intronic
1159655980 18:71030797-71030819 CTCTACCAATCAGCAGGATGTGG - Intergenic
1160685727 19:435844-435866 CTCCCGCAATGGGCAGAAAACGG - Intronic
1162107135 19:8376644-8376666 CTCTACCAATCAGCAGGATGTGG + Intronic
1162232965 19:9282932-9282954 CTCTACCAATCAGCAGGATGTGG - Intergenic
1162261956 19:9541093-9541115 CTCTACCAATCAGCAGGATGTGG - Intergenic
1162837850 19:13333013-13333035 CACCATCAGTCAGCAGAGAATGG - Intronic
1163131950 19:15279706-15279728 CTCCAGCAATCAGCAGATTCTGG - Intronic
1163181582 19:15608088-15608110 CTCTACCAATCAGCAGGATGTGG - Intergenic
1164143916 19:22498628-22498650 CTCTACCAATCAGCAGGATGTGG - Intronic
1164270386 19:23667422-23667444 CTCTACCAATCAGCAGGATGTGG - Intronic
1164353893 19:27392533-27392555 CTCTACAAATCAGCAGGAAGTGG - Intergenic
1164975938 19:32572630-32572652 CTCTACCAATCAGCAGGATGTGG + Intergenic
1165022659 19:32936670-32936692 CTCCAGCTATCAGCAGAGAGGGG - Intronic
1165036501 19:33037362-33037384 CTCTACCAATCAGCAGGATGTGG + Intronic
1166036096 19:40169742-40169764 CTCTACCAATCAGCAGGACATGG - Intergenic
1166461391 19:42991510-42991532 CTCCAGCAAGAAGCAGAAAAGGG + Intronic
1166478682 19:43151489-43151511 CTCCAGCAAGAAGCAGAAAAGGG + Intronic
1166486873 19:43221405-43221427 CTCTACCAATCAGCAGGATGTGG - Intronic
1166501354 19:43343825-43343847 CTCCAGCAAGAAGCAGAAAAGGG + Intergenic
1166508756 19:43389623-43389645 CTCCAGCAAGAAGCAGAAAAGGG - Intergenic
1202673102 1_KI270710v1_random:12834-12856 TTCCATCACGCAGCAGAAAAAGG + Intergenic
925098855 2:1229202-1229224 CTCTACCAATCAGCAGGATGTGG - Intronic
925537682 2:4934912-4934934 CTCTACCAATCAGCAGGATGTGG - Intergenic
926098234 2:10096655-10096677 CCCCACCCATCACCAGAACAGGG - Intergenic
926826539 2:16911890-16911912 CTTCACAAGGCAGCAGAAAAGGG + Intergenic
926850768 2:17194271-17194293 CTCCACCAATCAGCAGGATGTGG + Intergenic
927357199 2:22187061-22187083 CTCTACCAATCAGCAGGATGTGG + Intergenic
927777932 2:25916392-25916414 CTCTACCAATCAGCAGGATGTGG + Intergenic
928493192 2:31804402-31804424 CTCTACCAATCAGCAGGAGGTGG + Intergenic
928753310 2:34495015-34495037 CTCTACCAATCAGCAGGATGTGG + Intergenic
928937019 2:36688982-36689004 CTCTACCAATCAGCAGGATGTGG + Intergenic
929233826 2:39586077-39586099 CTCTACCAATCAGCAGGATGTGG + Intergenic
929890730 2:45917108-45917130 CTCTACCAATCAGCAGGATGTGG - Intronic
930038134 2:47100495-47100517 CTCTACCAATCAGCAGGATGTGG + Intronic
930039352 2:47108200-47108222 CTCTACCAATCAGCAGGATGTGG + Intronic
930468104 2:51779891-51779913 CTCCACCAATCAGCAGGATGTGG - Intergenic
930485631 2:52007530-52007552 CTCTACCAATCAGCAGGACGTGG + Intergenic
931130467 2:59329892-59329914 CTATTCCAATCAACAGAAAAAGG + Intergenic
932240074 2:70149305-70149327 CTCTACCAATCAGCAGGATGTGG + Intergenic
932359386 2:71091967-71091989 CTCTACCAATCAGCAGGATGTGG - Intergenic
932393714 2:71422645-71422667 TCCAACCAATCAGCATAAAATGG - Intronic
932521933 2:72422907-72422929 CTCTACCAATCAGCAGGATGTGG + Intronic
932902184 2:75712495-75712517 CTCTACCAATCAGCAGGATGTGG + Intergenic
933487126 2:82937961-82937983 CTCTACCAATCAGCAGGATGTGG - Intergenic
933511346 2:83245573-83245595 CTCTACCAATCAGCAGGATGTGG - Intergenic
934898615 2:98139765-98139787 CTCTACCAATCAGCAGAATGTGG + Intronic
935896727 2:107746988-107747010 CTCTACCAATCAGCAGGATGTGG - Intergenic
936347029 2:111682773-111682795 CTCTACCAATCAGCAGGACGTGG + Intergenic
937209469 2:120259270-120259292 CTCTACCAATCAGCAGGATGTGG - Intronic
937597121 2:123685888-123685910 CTCTACCAATCAGCAGGATGTGG + Intergenic
937711733 2:124987054-124987076 CTCTACCAATCAGCAGGATGTGG - Intergenic
937746744 2:125423290-125423312 CTCTACCAATCAGCAGGATGTGG + Intergenic
937786179 2:125901542-125901564 TTAAACCAATCAGCAAAAAAGGG - Intergenic
938401147 2:130992207-130992229 CTCTACCAATCAGCAGGATGTGG + Intronic
939053057 2:137330855-137330877 CTCTACCAATCAGCAGGACGTGG - Intronic
939229862 2:139410894-139410916 CTCTACCAATCAGCAGGATGTGG + Intergenic
939281882 2:140074543-140074565 CTCTACCAATCAGCAGGATGTGG + Intergenic
939777225 2:146403173-146403195 CTCTACCAATCAGCAGGATGTGG - Intergenic
939972436 2:148678047-148678069 CTCTACCAATCAGCAGGATGTGG - Intronic
940784498 2:157967603-157967625 CTCTACCAATCAGCAGGATGTGG - Intronic
940944531 2:159600576-159600598 ATCCACCAAACAGGACAAAAAGG + Intronic
941240206 2:163026998-163027020 CTCTACCAATCAGCAGGACGTGG + Intergenic
941705731 2:168656801-168656823 CTCTACCAATCAGCAGGATGTGG - Intronic
942662621 2:178282351-178282373 CTCCACTAAGCAGCAGCAGAGGG - Intronic
943494632 2:188606083-188606105 CTCTACCAATCAGCAGGATGTGG - Intergenic
943680221 2:190760548-190760570 CTCTACCAATCAGCAGGAAGTGG - Intergenic
943713137 2:191120515-191120537 CTCAACCAATCAACAGGCAAAGG + Intronic
943835274 2:192508731-192508753 CTCTACCAATCAGCAGGATGTGG + Intergenic
944729759 2:202504133-202504155 CTCTACCAATCAGCAGGACGTGG + Intronic
944857798 2:203785102-203785124 CTCTACCAATCAGCAGGATGTGG - Intergenic
945575340 2:211523856-211523878 CTCTACCAATCAGCAGGACGTGG - Intronic
945745925 2:213719531-213719553 CTCTACCAATCAGCAGGATGTGG + Intronic
946150782 2:217767262-217767284 ATCAACCAATCTGAAGAAAAGGG + Intergenic
946357959 2:219200910-219200932 CTCTACCAATCAGCAGGATGTGG - Intronic
946923427 2:224603179-224603201 CTCTACCAATCAGCAGGATGTGG - Intergenic
946982036 2:225229010-225229032 CTCTACCAATCAGCAGGATGTGG - Intergenic
947026758 2:225744894-225744916 CTCTACCAATCAGCAGGATGTGG + Intergenic
947412108 2:229851468-229851490 CTCTACCAATCAGCAGGATGTGG + Intronic
947931920 2:233971906-233971928 CTCTACCAATCAGCAGGATGTGG - Intronic
948456742 2:238107941-238107963 CTCCACGACGCAGCAGAGAACGG + Exonic
1168985545 20:2045504-2045526 CTGAATCAATAAGCAGAAAAGGG + Intergenic
1169814316 20:9641027-9641049 CTCTACCAATCAGCAGGATGTGG - Intronic
1169849312 20:10032441-10032463 CTCTACCAATCAGCAGGATGTGG + Intronic
1170246585 20:14227219-14227241 CTCTACCAATCAGCAGGATGTGG + Intronic
1170806705 20:19639066-19639088 CTCTACCAATCAGCAGGATGTGG - Intronic
1170990015 20:21292641-21292663 CTCTACCAATCAGCAGGACGTGG + Intergenic
1172431715 20:34898280-34898302 CTCTACCAATCAGCAGGATGTGG - Intronic
1173195397 20:40909948-40909970 CTCTACCAATCAGCAGGATGTGG - Intergenic
1173195808 20:40911905-40911927 CTCTACCAATCAGCAGGATGTGG + Intergenic
1173462439 20:43254086-43254108 CTACACCACTCAGAAAAAAAGGG + Intergenic
1174908643 20:54580594-54580616 CATCACTAATCATCAGAAAAAGG - Intronic
1175074218 20:56359591-56359613 CTCTTCCACTCAGAAGAAAAGGG - Intronic
1175210196 20:57349188-57349210 CTCTACCAATCAGCAGGATGTGG + Intergenic
1175254281 20:57629619-57629641 CTCTACCAATCAGCAGGATGTGG + Intergenic
1175420261 20:58827659-58827681 CTACAGGAATCAGCAGGAAAGGG + Intergenic
1176634455 21:9177257-9177279 TTCCATCACACAGCAGAAAAAGG + Intergenic
1176638863 21:9277537-9277559 TTCCATCACGCAGCAGAAAAGGG - Intergenic
1176966483 21:15218054-15218076 CTCTACCAATCAGCAGGATATGG - Intergenic
1177041435 21:16116265-16116287 GTCCACCAATCAGCATAAGGTGG + Intergenic
1178082128 21:29076843-29076865 CTCTACCAATCAGCAGGATGTGG - Intergenic
1178327103 21:31654857-31654879 CTCTACCAATCAGCAGGATGTGG + Intergenic
1178398884 21:32266330-32266352 CTCTACCAATCAGCAGGATGTGG + Intergenic
1178465223 21:32841704-32841726 CTGCACCAAGCTGCAGAACAAGG - Intergenic
1178585547 21:33868125-33868147 CTCTACCAATCAGCAGGATGTGG - Intronic
1179164431 21:38924661-38924683 CTCCACCAATCCCAAGAAAGGGG + Intergenic
1179176949 21:39014889-39014911 CTCCACGAATCAGCAAACAAAGG + Intergenic
1180372168 22:12050381-12050403 TTCCATCACGCAGCAGAAAAAGG - Intergenic
1180390310 22:12225261-12225283 TTCCATCACGCAGCAGAAAAAGG + Intergenic
1180415625 22:12709208-12709230 TTCCATCACGCAGCAGAAAAAGG - Intergenic
1180422906 22:12885043-12885065 TTCCATCACGCAGCAGAAAAGGG - Intergenic
1180740902 22:18052808-18052830 CTCTACCAATCAGCAGGATGTGG - Intergenic
1181256998 22:21568998-21569020 CACCACCATTCACCAGATAAGGG + Intronic
1183685354 22:39358321-39358343 CTCTACCAATCAGCAGGATGTGG + Intronic
1184584353 22:45437281-45437303 CTCTACCAATCAGCAGGATGTGG + Intergenic
950256543 3:11511235-11511257 CTCTACCAATCAGCAGGATGTGG - Intronic
950513237 3:13446678-13446700 CTCTACCAATCAGCAGGATGTGG - Intergenic
950600222 3:14028781-14028803 CTCTACCAATCAGCAGGATGTGG - Intronic
950895506 3:16446704-16446726 CAACTCCAAACAGCAGAAAATGG + Intronic
950929537 3:16774600-16774622 CTCTACCAATCAGCAGGATGTGG + Intergenic
951407732 3:22321756-22321778 CACCAGCAATCATAAGAAAAAGG - Intronic
951874028 3:27400667-27400689 ATCCATCAATCAAGAGAAAATGG + Intronic
951950946 3:28199893-28199915 CTCTACCAATCAGCAGGACGTGG - Intergenic
952057954 3:29472914-29472936 CTCTACCAATCAGCAGGATGTGG - Intronic
952275388 3:31871039-31871061 CTCTACCAATCAGCAGGACGTGG + Intronic
952393877 3:32903913-32903935 CTCTACCAATCAGCAGGATGTGG + Intergenic
952398381 3:32940681-32940703 CTCTACCAATCAGCAGGATGTGG + Intergenic
952583260 3:34860776-34860798 CTACAGCAATCAACAGAAAGAGG - Intergenic
952713438 3:36454066-36454088 CTCTACCAATCAGCAGGATGTGG + Intronic
952730831 3:36635102-36635124 CTCTACCAATCAGCAGGATGCGG + Intergenic
952795369 3:37233781-37233803 CTCTACCAATCAGCAGGATGTGG + Intergenic
953003005 3:38951873-38951895 CTCTACCAATCAGCAGAATGTGG + Intergenic
953089961 3:39714196-39714218 CTCTACCAATCAGCAGGATGTGG + Intergenic
953124358 3:40077337-40077359 CTCTACCAATCAGCAGGATGTGG - Intronic
953307485 3:41843807-41843829 CTCTACCAATCAGCAGGATGTGG - Intronic
953522322 3:43655550-43655572 CTCTACCAATCAGCAGGACATGG - Intronic
953675061 3:44994639-44994661 CTTCACACATCAGCAGAATATGG + Intronic
954041148 3:47888209-47888231 CTCTACCAATCAGCAGGATGTGG + Intronic
954226080 3:49182261-49182283 CTCTACCAATCAGCAGGATGTGG - Intronic
954620256 3:51991285-51991307 CTCTACCAATCAGCAGGATGTGG + Intergenic
955183479 3:56692643-56692665 CTCTACCAATCAGCAGGATGTGG + Intergenic
955186539 3:56719735-56719757 CTCTACCAATCAGCAGGATGTGG + Intergenic
955210421 3:56935347-56935369 CTCTACCAATCAGCAGGATGTGG + Intronic
955266312 3:57448668-57448690 CTCTACCAATCAGCAGGATGTGG - Intronic
955449599 3:59051578-59051600 CTCTACCAATCAGCAGGATGTGG + Intergenic
956195864 3:66652290-66652312 CTCTACCAATCAGCAGGATGTGG + Intergenic
956392062 3:68784755-68784777 CTCTACCAATCAGCAGGATGTGG - Intronic
956855380 3:73269914-73269936 CTCTACCAATCAGCAGGATGTGG + Intergenic
957009052 3:74984604-74984626 CTCTACCAATCAGCAGGATGTGG - Intergenic
957101996 3:75839534-75839556 TTCCATCACGCAGCAGAAAAAGG + Intergenic
957277591 3:78109151-78109173 CTCTACCAATCAGCAGGACGTGG + Intergenic
957419521 3:79950850-79950872 CTCTACCAATCAGCAGGATGTGG - Intergenic
957446239 3:80315215-80315237 CTCTACCAATCAGCAGGATGTGG + Intergenic
957560041 3:81811606-81811628 CTCTACCAATCAGCAGGATGTGG - Intergenic
957829915 3:85504483-85504505 CTCTACCAATCAGCAGGATGTGG - Intronic
957921942 3:86758362-86758384 CTCTACCAATCAGCAGGATGTGG + Intergenic
957995235 3:87679980-87680002 CTCTACCAATCAGCAGGATGTGG + Intergenic
958022757 3:88016401-88016423 CTCTACCAATCAGCAGGATGTGG + Intergenic
959231333 3:103656110-103656132 TTCCACCAAGCAACAGAACAGGG + Intergenic
960063338 3:113346755-113346777 ATGGACCAATCAGCAGGAAATGG + Intronic
960149645 3:114237610-114237632 CTCTACCAATCAGCAGGATGTGG - Intergenic
960199278 3:114812218-114812240 CTCTACCAATCAGCAGGATGTGG - Intronic
960227426 3:115184645-115184667 CTCTACCAATCAGCAGGATGTGG - Intergenic
961460594 3:127047557-127047579 CTCTACCAATCAGCAGGACGTGG + Intergenic
962283636 3:134069899-134069921 CTCTACCAATCAGCAGGATGTGG - Intronic
962398626 3:135038905-135038927 CTCTACCAATCAGCAGGATGTGG - Intronic
962590948 3:136889599-136889621 CTCTACCAATCAGCAGCATGTGG - Intronic
962600377 3:136987183-136987205 CTCTACCAATCAGCAGGACGTGG - Intronic
962758387 3:138485610-138485632 CTCTACCAATCAGCAGGATGTGG + Intergenic
963397356 3:144750731-144750753 CTCTACCAATCAGCAGGACGTGG + Intergenic
963431145 3:145205257-145205279 ATGGACCAATCAGCAGAACATGG - Intergenic
963440528 3:145334051-145334073 CTCTACCAATCAGCAGGATGGGG + Intergenic
963512156 3:146260040-146260062 CTCCACCAGTCAGGAGGGAAGGG + Intergenic
963589875 3:147245238-147245260 CTCTACCAATCAGCAGGATGTGG - Intergenic
963742801 3:149097318-149097340 CTCTACCAATCAGCAGGATGTGG - Intergenic
963862278 3:150323523-150323545 CTCTACCAATCAGCAGGATGTGG + Intergenic
964014523 3:151929080-151929102 CTCTACCAATCAGCAGGATGTGG + Intergenic
964075969 3:152692273-152692295 CTCAAAAAATCAGCATAAAAGGG + Intergenic
964117854 3:153155350-153155372 CTCTACCAATCAGCAGGATGTGG - Intergenic
964139088 3:153377814-153377836 CTCTACCAATCAGCAGGATGTGG - Intergenic
964381218 3:156100176-156100198 CTCTACCAATCAGCAGCATGTGG + Intronic
964444122 3:156741290-156741312 CTCTACCAATCAGCAGGATGTGG + Intergenic
964452008 3:156822115-156822137 CTCTACCAATCAGCAGGATATGG - Intergenic
964802770 3:160573585-160573607 CTCTACCAATCAGCAGGATGTGG - Intergenic
965044020 3:163551971-163551993 CTCTACCAATCAGCAGGATGTGG - Intergenic
965078123 3:164003731-164003753 CTCTACCAATCAGCAGGACGTGG + Intergenic
965109304 3:164401576-164401598 CTCTACCAATCAGCAGGATGTGG - Intergenic
965200226 3:165648916-165648938 CTCTACCAATCAGCAGGATGTGG - Intergenic
965245114 3:166258057-166258079 CTCTACCAATCAGCAGGATGTGG - Intergenic
965256882 3:166424535-166424557 CTCTACCAATCAGCAGGACGTGG + Intergenic
965288173 3:166843602-166843624 CTCTACCAATCAGCAGGATGTGG + Intergenic
965298227 3:166976386-166976408 CTCTACCAATCAGCAGGATGTGG + Intergenic
965446602 3:168781027-168781049 CTCTACCAATCAGCAGGATGTGG + Intergenic
965753101 3:171998390-171998412 CTCTACCAATCAGCAGGATGTGG - Intergenic
965837489 3:172867504-172867526 CTCTACCAATCAGCAGGATGTGG + Intergenic
965943329 3:174211281-174211303 CTCTACCAATCAGCAGGATGTGG - Intronic
966076200 3:175938295-175938317 CTCTACCAATCAGCAGGATGTGG + Intergenic
966096660 3:176213013-176213035 CTCTACCAATCAGCAGGATGTGG - Intergenic
966190872 3:177271167-177271189 CTCTACCAATCAGCAGGACATGG - Intergenic
966725121 3:183101622-183101644 CTCTACCAATCAGCAGGATGTGG + Intronic
966725300 3:183103345-183103367 CTCTACCAATCAGCAGGATGTGG - Intronic
966850732 3:184163644-184163666 CTTCACCACTCTGCAGAGAAAGG - Exonic
967448600 3:189596677-189596699 CTCTACCAATCAGCAGGAAGTGG + Intergenic
967499012 3:190176530-190176552 CTCTACCAATCAGCAGGATGTGG - Intergenic
1202748032 3_GL000221v1_random:127482-127504 TTCCATCACGCAGCAGAAAAGGG + Intergenic
968687923 4:1973900-1973922 CTCCACCCAGCAGCAGGGAATGG - Intronic
968716282 4:2162031-2162053 CTCTACCAATCAGCAGGATGTGG + Intronic
968804334 4:2762792-2762814 CTCTACCAATCAGCAGGATGTGG - Intergenic
969362465 4:6673378-6673400 CTCTACCAATCAGCAGGATGTGG + Intergenic
969440862 4:7215892-7215914 CTCTACCAATCAGCAGGATGTGG + Intronic
969654835 4:8490809-8490831 CTCTACCAATCAGCAGGATGTGG - Intronic
970051384 4:11918557-11918579 CTCTACCAATCAGCAGGATGTGG + Intergenic
970391351 4:15615796-15615818 CTCTACCAATCAGCAGGATGTGG + Intronic
970621547 4:17825899-17825921 CTCCACAAATAAGAGGAAAATGG - Intronic
970673043 4:18417935-18417957 CTCTACCAATCAGCAGGATGTGG - Intergenic
971261437 4:25060496-25060518 CTCCCCCAATCATCAGAAAAGGG + Intergenic
971376985 4:26063567-26063589 CTCTACCAATCAGCAGGACGTGG - Intergenic
971552920 4:27977973-27977995 CTCTACCAATCAGCAGGATGTGG - Intergenic
971709575 4:30093420-30093442 CTCTACCAATCAGCAGGATGTGG + Intergenic
971812086 4:31439533-31439555 CTCTACCAATCAGCAGGATGTGG + Intergenic
972022683 4:34335397-34335419 CTCTACCAATCAGCAGGATGTGG - Intergenic
972900269 4:43673358-43673380 CTCTACCAATCAGCAGGATGTGG + Intergenic
973190191 4:47377641-47377663 CTCTACCAATCAGCAGGATGTGG - Intronic
973308196 4:48676106-48676128 CTCTACCAATCAGCAGGATGTGG + Intronic
973333896 4:48936654-48936676 CTGCACCAAGCTGCAGAACAAGG + Intergenic
973392528 4:49568558-49568580 CTCCAGAAATTTGCAGAAAATGG + Intergenic
973587620 4:52409181-52409203 CTTTACCAATCAGCAGGACATGG - Intergenic
973764961 4:54154600-54154622 CTCTACCAATCAGCAGGATGTGG - Intronic
974147542 4:57966188-57966210 CTCTACCAATCAGCAGGACGTGG + Intergenic
974590463 4:63942481-63942503 CTCTACCAATCAGCAGGATGTGG - Intergenic
974637782 4:64588129-64588151 CACCACTAATCATCAGAAAAAGG + Intergenic
974641627 4:64640070-64640092 CTCTACCAATCAGCAGGATGTGG - Intergenic
974804514 4:66860931-66860953 CTCTACCAATCAGCAGGATGTGG + Intergenic
974827881 4:67152602-67152624 CTCTACCAATCAGCAGGATGTGG + Intergenic
974992743 4:69114759-69114781 CTCTACCAATCAGCAGGATTGGG - Intronic
975055521 4:69924654-69924676 CTCTACCAATCAGCAGGATGTGG + Intergenic
975298925 4:72766569-72766591 CTCTACCAATCAGCAGGATGTGG + Intergenic
975302937 4:72812612-72812634 CTCCTACAATCACCAGAAACAGG - Intergenic
975595063 4:76042892-76042914 CTCTACCAATCAGCAGGACGTGG - Intronic
975756012 4:77571664-77571686 CTCTACCAATCAGCAGGATGTGG + Intronic
976520486 4:86020970-86020992 CTCTACCAATCAGCAGGATGTGG - Intronic
976565635 4:86547957-86547979 CTCTACCAATCAGCAGGATGTGG + Intronic
976646750 4:87395543-87395565 CTCTACCAATCAGCAGGATGTGG - Intergenic
976980144 4:91217289-91217311 CTCTACCAATCAGCAGGATGTGG - Intronic
977174771 4:93806829-93806851 CTGCACCAATCATCACAAATGGG + Intergenic
977717226 4:100196117-100196139 CTCTACCAATCAGCAGGATGTGG - Intergenic
977906605 4:102484171-102484193 CTCCACCAATCAGCAGGATGTGG + Intergenic
978080366 4:104582695-104582717 CTCTACCAATCAGCAGGATGTGG + Intergenic
978241763 4:106524945-106524967 CTCTACCAATCAGCAGGATGTGG - Intergenic
978463500 4:108983988-108984010 CTCTACCAATCAGCAGGATGTGG - Intronic
978997923 4:115179080-115179102 CTCTACCAATCAGCAGGATTTGG - Intergenic
978999461 4:115199791-115199813 CTCTACCAATCAGCAGGATGTGG - Intergenic
979308463 4:119174668-119174690 CTCTACCAATCAGCAGGATGTGG + Intronic
979424637 4:120550375-120550397 CTCTACCAATCAGCAGGATGTGG - Intergenic
979755990 4:124339775-124339797 CTCTACCAATCAGCAGGATGTGG + Intergenic
979822667 4:125192693-125192715 CTCTACCAATCAGCAGGATGTGG + Intergenic
979825589 4:125229270-125229292 CTCTACCAATCAGCAGGATGTGG - Intergenic
979857397 4:125651410-125651432 CTCTACCAATCAGCAGGATGTGG - Intergenic
979899590 4:126200932-126200954 CTCTACCAATCAGCAGTATGTGG - Intergenic
979991626 4:127381143-127381165 CTCTACCAATCAGCAGGATGTGG + Intergenic
980043260 4:127963834-127963856 CTCTACCAATCAGCAGGATGTGG - Intronic
980051810 4:128047197-128047219 CTCTACCAATCAGCAGGATGTGG - Intergenic
980228139 4:130013866-130013888 CTCTACCAATCAGCAGGATGTGG + Intergenic
980230135 4:130038145-130038167 CTCTACCAATCAGCAGGATGTGG - Intergenic
980470084 4:133239884-133239906 CTCTACCAATCAGCAGGATGTGG - Intergenic
980628737 4:135407579-135407601 CTCTACCAATCAGCAGGATGTGG + Intergenic
980799887 4:137734499-137734521 CTCTACCAATCAGCAGGACATGG + Intergenic
981146604 4:141332665-141332687 CTCTACCAATCAGCAGGATGTGG - Intergenic
981176452 4:141689303-141689325 CTCTACCAATCAGCAGGATGTGG - Intronic
981275939 4:142898261-142898283 CTCTACCAATCAGCAGGACGTGG + Intergenic
982408357 4:155045142-155045164 CTCTACCAATCAGCAGGATGTGG + Intergenic
982814454 4:159868629-159868651 CTCTACCAATCAGCAGGACTGGG - Intergenic
982868682 4:160549744-160549766 CTCTACCAATCAGCAGGATGTGG - Intergenic
983026231 4:162740424-162740446 CTCTACCAATCAGCAGATGTGGG + Intergenic
983060472 4:163153733-163153755 CTCTACCAATCAGCAGGATGTGG + Intronic
983401412 4:167271041-167271063 CTATTCCAATCAACAGAAAAAGG + Intergenic
983552907 4:169035194-169035216 CTCTACCAATCAGCAGGATGTGG - Intergenic
983752969 4:171299042-171299064 CTCTACCAATCAGCAGGATGTGG + Intergenic
984192695 4:176624657-176624679 CTCTACCAATCAGCAGGATGTGG - Intergenic
984238693 4:177192793-177192815 CTCTACCAATCAGCAGGATGTGG - Intergenic
984241724 4:177227212-177227234 CTCTACCAATCAGCAGGATGTGG - Intergenic
984265789 4:177496353-177496375 CTCTACCAATCAGCAGGATGTGG + Intergenic
984662390 4:182387451-182387473 CTCTACCAATCAGCAGGATGTGG + Intronic
984770699 4:183434027-183434049 CTCTACCAATCAGCAGGATGTGG + Intergenic
984775984 4:183482286-183482308 CTCTACCAATCAGCAGGACGTGG - Intergenic
984901865 4:184592589-184592611 CTCTACCAATCAGCAGGATGTGG + Intergenic
985087210 4:186325264-186325286 CTCTACCAATCAGCAGGATGTGG + Intergenic
985129204 4:186724379-186724401 CTCCTTCAATCCCCAGAAAATGG + Intronic
985194970 4:187419897-187419919 CTCTACCAATCAGCAGGATGTGG - Intergenic
985203374 4:187506390-187506412 CTCTACCAATCAGCAGGATGTGG + Intergenic
985403742 4:189616247-189616269 CTCTACCAATCAGCAGGATGTGG - Intergenic
1202753752 4_GL000008v2_random:35949-35971 TTCCATCACGCAGCAGAAAAAGG - Intergenic
986185564 5:5433238-5433260 CTCCCCCATCCAGCAGAAAGAGG - Intronic
986698127 5:10376039-10376061 CTCTACCAATCAGCAGGATGTGG + Intronic
986756075 5:10837967-10837989 CTGCTCCAATCATGAGAAAATGG + Intergenic
987156635 5:15096084-15096106 CTCTACCAATCAGCAGGACGTGG - Intergenic
987306220 5:16640329-16640351 CTCCAGTAATCAGCAGAGAGTGG + Intergenic
987315434 5:16718953-16718975 CTCTACCAATCAGCAGGATGTGG + Intronic
987331602 5:16862121-16862143 TCCCACCACTCAGCAGAAAGGGG + Intronic
987383892 5:17311452-17311474 CTCTACCAATCAGCAGGATGTGG - Intergenic
987476557 5:18399258-18399280 CTCTACCAATCAGCAGGATGTGG - Intergenic
987532657 5:19142367-19142389 CTCTACCAATCAGCAGGATATGG - Intergenic
987896419 5:23952129-23952151 CTCTACCAATCAGCAGGATGTGG + Intronic
987990060 5:25199079-25199101 CTCTACCAATCAGCAGGATGTGG - Intergenic
988073630 5:26325224-26325246 CTCTACCAATCAGCAGGATGTGG + Intergenic
988086845 5:26484758-26484780 CTCCACCAATCAGCAGGATGTGG - Intergenic
988132277 5:27120620-27120642 CTCTACCAATCAGCAGGATGTGG + Intronic
988154922 5:27438929-27438951 CTCTACCAATCAGCAGGATGTGG - Intergenic
988177413 5:27744382-27744404 CTCTACCAATCAGCAGGACGTGG + Intergenic
988369364 5:30346305-30346327 CTCTACCAATCAGCAGGATGTGG + Intergenic
988684614 5:33514985-33515007 CTCTACCAATCAGCAGGACGTGG - Intergenic
988857379 5:35241713-35241735 CACCACTAATCATCAGAGAAAGG - Intergenic
988915762 5:35892345-35892367 CTCTACCAATCAGCAGGATGTGG - Intergenic
989003329 5:36783344-36783366 CTCTACCAATCAGCAGGAGGTGG + Intergenic
989346922 5:40439436-40439458 CTCTACCAATCAGCAGGATGTGG + Intergenic
989760995 5:45016169-45016191 ATGCACCAATCAGCAGGACATGG - Intergenic
989956974 5:50370270-50370292 CTCTACCAATCAGCAGGATGTGG + Intergenic
989958034 5:50377503-50377525 CTCTACCAATCAGCAGGATGTGG + Intergenic
989965953 5:50465896-50465918 CTCTACCAATCAGCAGGATGTGG + Intergenic
990461637 5:56036212-56036234 CTCTACCAATCAGCAGGATGTGG + Intergenic
990490222 5:56296367-56296389 CTCTACCAATCAGCAGGATGTGG + Intergenic
990492533 5:56316379-56316401 ACCAACCAATCAGCAGCAAACGG + Intergenic
990763536 5:59157190-59157212 TTCCACCAGTCAGCATAAAATGG + Intronic
990891214 5:60652308-60652330 CTCCACCAGTCAGCCAAAACCGG + Intronic
991330108 5:65485075-65485097 CTCTACCAATCAGCAGGATGTGG - Intergenic
991567437 5:68020001-68020023 CTCTACCAATCAGCAGGACGTGG - Intergenic
991670586 5:69043502-69043524 ATCTCCTAATCAGCAGAAAAGGG - Intergenic
992296868 5:75334525-75334547 CTCTACCAATCAGCAGGATGTGG + Intergenic
992947565 5:81824427-81824449 CTCTACCAATCAGCAGGAAGTGG + Intergenic
992990527 5:82278564-82278586 CTCCAGCATTCAAAAGAAAAAGG - Exonic
993320812 5:86466278-86466300 CTCTACCAATCAGCAGGATGTGG - Intergenic
993822178 5:92632205-92632227 CTCTACCAATCAGCAGGATGTGG + Intergenic
994096492 5:95852163-95852185 CTCTACCAATCAGCAGGATGTGG + Intergenic
994230085 5:97301912-97301934 CTCTACCAATCAGCAGGATGTGG + Intergenic
994254670 5:97579591-97579613 CTCTACCAATCAGCAGGATGTGG - Intergenic
994507227 5:100657398-100657420 CTCTACCAATCAGCAGGATGTGG + Intergenic
994509693 5:100688303-100688325 CTCCACCAATCAGCAGGATGTGG - Intergenic
994605458 5:101961804-101961826 CTCTACCAATCAGCAGGATGTGG - Intergenic
994701565 5:103141513-103141535 CTCTACCAATCAGCAGGATGTGG - Intronic
994769668 5:103965925-103965947 CTCTACCAATCAGCAGGATGTGG - Intergenic
994935396 5:106246924-106246946 CTCTACCAATCAGCAGGATGTGG + Intergenic
995032435 5:107495033-107495055 CTCTACCAATCAGCAGGATGTGG + Intronic
995276260 5:110281191-110281213 CTATTCCAATCAACAGAAAAAGG - Intergenic
995326283 5:110893505-110893527 CTCTACCAATCAGCAGGATGTGG - Intergenic
995596341 5:113752756-113752778 CTCTACCAATCAGCAGGATGCGG - Intergenic
995656632 5:114433442-114433464 CTCTACCAATCAGCAGGATGTGG + Intronic
995920570 5:117305865-117305887 CTCTACCAATCAGCAGGATGTGG + Intergenic
996107184 5:119518022-119518044 CTCTACCAATCAGCAGGACGTGG + Intronic
996234358 5:121108050-121108072 CTCTACCAATCAGCAGGATGTGG + Intergenic
996435827 5:123431319-123431341 CTCTACCAATCAGCAGGATGTGG + Intergenic
997015496 5:129929546-129929568 CTACACTAATCACCAGAACAAGG - Intronic
997760703 5:136445151-136445173 CTCTACCAATCAGCAGGATGTGG + Intergenic
998227974 5:140341624-140341646 CTGCACCAATCACCAGTAGAAGG + Intronic
999482985 5:151965909-151965931 CTCCCCCACTCAGCAGATAGGGG - Intergenic
999855148 5:155586271-155586293 CTCTACCAATCAGCAGGATGTGG - Intergenic
1000066148 5:157694552-157694574 CTCTACCAATCAGCAGGATGTGG + Intergenic
1000329063 5:160193495-160193517 CTCTACCAATCAGCAGGATGTGG - Intronic
1000934864 5:167295328-167295350 CATCACCAATAATCAGAAAAAGG - Intronic
1000981655 5:167823217-167823239 CTCCACCAATCTGCAAAATATGG - Intronic
1001143529 5:169164661-169164683 CTCCACATACCAGCAGGAAAGGG - Intronic
1002004484 5:176221385-176221407 CTCTACCAATCAGCAGGACGTGG - Intergenic
1002221889 5:177689235-177689257 CTCTACCAATCAGCAGGACGTGG + Intergenic
1002789235 6:425639-425661 CTCTACCAATCAGCAGGATGTGG - Intergenic
1003060875 6:2861142-2861164 CTCTACCAATCAGCAGGATGTGG + Intergenic
1003082024 6:3028391-3028413 CTCTACCAATCAGCAGGATGTGG + Intergenic
1003100319 6:3171524-3171546 CTCTACCAATCAGCAGGATGTGG + Intergenic
1003170708 6:3720124-3720146 CTCTACCAATCAGCAGGATGTGG - Intergenic
1003329814 6:5120617-5120639 CTGGACCAATCAGCAGGACATGG - Intronic
1003581560 6:7344979-7345001 CTCTACCAATCAGCAGGATGTGG + Intronic
1003671669 6:8165120-8165142 CTCTACCAATCAGCAGGACGTGG + Intergenic
1003717860 6:8667128-8667150 CTCTACCAATCAGCAGGATGTGG + Intergenic
1003737019 6:8887887-8887909 CTCTACCAATCAGCAGGATGTGG + Intergenic
1003748156 6:9025145-9025167 CTCTACCAATCAGCAGGATGTGG + Intergenic
1003770031 6:9290080-9290102 CTCTACCAATCAGCAGGATGAGG - Intergenic
1003845857 6:10172518-10172540 CTCTACCAATCAGCAGGATGTGG + Intronic
1003862911 6:10338134-10338156 CTCTACCAATCAGCAGGATGTGG + Intergenic
1003908273 6:10721505-10721527 CTCTACCAATCAGCAGGATGTGG + Intergenic
1003947412 6:11088093-11088115 CTCTACCAATCAGCAGGATGTGG + Intergenic
1003982346 6:11402180-11402202 CTCTACCAATCAGCAGGATGTGG - Intergenic
1004037109 6:11933961-11933983 CTCTACCAATCAGCAGGATGTGG + Intergenic
1004053014 6:12107826-12107848 CTCTACCAATCAGCAGGATGTGG - Intronic
1004224510 6:13773253-13773275 CTCTACCAATCAGCAGGATGTGG + Intergenic
1004233601 6:13854216-13854238 CTCTACCAATCAGCAGGATGTGG - Intergenic
1004235401 6:13871259-13871281 CTCTACCAATCAGCAGTATGTGG - Intergenic
1004486153 6:16068797-16068819 CTCTACCAATCAGCAGGATGTGG - Intergenic
1004502036 6:16217833-16217855 CTCTACCAATCAGCAGGATGTGG - Intergenic
1004511763 6:16288967-16288989 CTCTACCAATCAGCAGGATATGG + Intronic
1004519437 6:16347768-16347790 ATGGACCAATCAGCAGAACATGG + Intronic
1004630427 6:17415917-17415939 CTTCACCAATGAGCACAAGATGG + Intronic
1004688958 6:17975637-17975659 CTCTACCAATCAGCAGGATGCGG - Intronic
1004906801 6:20244248-20244270 CTCTACCAATCAGCAGGATGTGG - Intergenic
1004912763 6:20302179-20302201 CTCTACCAATCAGCAGGATGTGG + Intergenic
1005035360 6:21551124-21551146 CTCTACCAATCAGCAGGATGTGG - Intergenic
1005332761 6:24765574-24765596 CTCTACCAATCAGCAGGATGTGG - Intergenic
1005596075 6:27380614-27380636 CTCTACCAATCAGCAGGATGTGG - Intronic
1005600740 6:27424424-27424446 CTCTACCAATCAGCAGGATGTGG - Intergenic
1005707329 6:28468949-28468971 CTCTACCAATCAGCAGGATGTGG - Intergenic
1005724928 6:28639223-28639245 CTCTACCAATCAGCAGGACGTGG - Intergenic
1005749804 6:28872229-28872251 CTCTACCAATCAGCAGGATGTGG - Intergenic
1005758768 6:28949392-28949414 CTCTACCAATCAGCAGGATGTGG - Intergenic
1005759950 6:28958880-28958902 CTCTACCAATCAGCAGGATGTGG + Intergenic
1005976893 6:30807079-30807101 CTCTACCAATCAGCAGGATGTGG - Intergenic
1005978069 6:30815576-30815598 CTCTACCAATCAGCAGGATGTGG - Intergenic
1006005898 6:31001229-31001251 CTCTACCAATCAGCAGGATGTGG + Intergenic
1006008462 6:31021763-31021785 CTCTACCAATCAGCAGGATGTGG + Intronic
1006033771 6:31196342-31196364 CTCTACCAATCAGCAGGATGTGG + Intergenic
1006226960 6:32547611-32547633 CTCTACCAATCAGCAGGATGTGG - Intergenic
1006352776 6:33533231-33533253 CTCTACCAATCAGCAGGATGTGG + Intergenic
1006477949 6:34269749-34269771 CTCTACCAATCAGCAGGATGTGG + Intergenic
1006696131 6:35932035-35932057 CTCTACCAATCAGCAGGATGTGG + Intergenic
1006748751 6:36363670-36363692 CTCTACCAATCAGCAGGATGTGG - Intronic
1007738842 6:43998796-43998818 CTCTACCAATCAGCAGGATGTGG + Intergenic
1007989584 6:46241160-46241182 CTCCACCAATCAGCAGAAAATGG - Intronic
1008005475 6:46405406-46405428 CTCTACCAATCAGCAGGATGTGG - Intronic
1008087034 6:47256162-47256184 CTGCACCAATCCACTGAAAATGG + Intronic
1008270087 6:49481633-49481655 CTCTACCAATCAGCAGGATGTGG - Intronic
1008270379 6:49483066-49483088 CTCTACCAATCAGCAGGATGTGG - Intronic
1008771134 6:54980120-54980142 CTCTACCAATCAGCAGGATGTGG + Intergenic
1009470385 6:64024459-64024481 CTCTACCAATCAGCAGGATGTGG + Intronic
1009471522 6:64031847-64031869 CTCTACCAATCAGCAGGATGTGG + Intronic
1009587780 6:65628383-65628405 CTCCACCAATCAGCAGGATGTGG + Intronic
1009685495 6:66950257-66950279 CTCTACCAATCAGCAGGATGTGG + Intergenic
1010066398 6:71686875-71686897 CTCTACCAATCAGCAGGATGTGG + Intergenic
1010235505 6:73572009-73572031 CTCTACCAATCAGCAGGATGTGG - Intergenic
1010763844 6:79755941-79755963 TCCCACCAAGCAGCAGAGAAGGG - Intergenic
1011049152 6:83124773-83124795 ATCCACCAGTAAGCAGAAATTGG - Exonic
1011143831 6:84190329-84190351 CTCTACCAATCAGCAGGATGTGG + Intronic
1011178231 6:84588154-84588176 CTCTACCAATCAGCAGGATGTGG + Intergenic
1011246671 6:85326967-85326989 CTCTACCAATCAGCAGGATGTGG + Intergenic
1011338242 6:86284465-86284487 CTCTACCAATCAGCAGGATGTGG - Intergenic
1011601725 6:89065793-89065815 CTCTACCAATCAGCAGGATGTGG + Intergenic
1012189203 6:96260423-96260445 CTCTACCAATCAGCAGAATGTGG - Intergenic
1012566900 6:100667534-100667556 CTACAGCAATCTGCAGAAGATGG + Intronic
1013080341 6:106806470-106806492 CTCTACCAATCAGCAGGATGTGG + Intergenic
1013081334 6:106816001-106816023 CTCTACCAATCAGCAGGATGTGG - Intergenic
1013143438 6:107363721-107363743 CTCTACCAATCAGCAGGATGTGG - Intronic
1013410664 6:109880742-109880764 CTCTACCAATCAGCAGGACGTGG - Intergenic
1013690351 6:112634338-112634360 CTTCACCACTCAACAGAAATTGG - Intergenic
1014056022 6:117015616-117015638 CTCTACCAATCAGCAGGATGTGG + Intergenic
1014240876 6:119016206-119016228 CTCTACCAATCAGCAGGATGTGG + Intronic
1014460148 6:121686051-121686073 CTCTACCAATCAGCAGGATGTGG - Intergenic
1014507897 6:122281506-122281528 CTCTACCAATCAGCAAAATGTGG + Intergenic
1014718696 6:124892897-124892919 CTCTACCAATCAGCAGGATTTGG + Intergenic
1014780978 6:125564298-125564320 CTCCAACAGTCATCAGAATAAGG - Intergenic
1014788601 6:125645213-125645235 CTCTACCAATCAGCAGGACGTGG + Intergenic
1014920954 6:127214228-127214250 CTCTACCAATCAGCAGGACGTGG - Intergenic
1015572149 6:134633350-134633372 CTCTACCAATCAGCAGGATGTGG - Intergenic
1015600486 6:134905613-134905635 CTCTACCAATCAGCAGGATGTGG + Intergenic
1016067249 6:139697520-139697542 CTCTACCAATCAGCAGGATGTGG - Intergenic
1016069776 6:139725974-139725996 CTCTACCAATCAGCAGGATGTGG - Intergenic
1016092701 6:139999182-139999204 CTCTACCAATCAGCAGGATGTGG - Intergenic
1016181570 6:141153827-141153849 ATCCCCCAATCTTCAGAAAAAGG + Intergenic
1016217309 6:141618817-141618839 CTCTACCAATCAGCAGGATGTGG + Intergenic
1016407971 6:143750983-143751005 CTCCAGCCCTCAGCTGAAAAGGG - Intronic
1016482173 6:144494586-144494608 CTCTACCAATCAGCAGGATGTGG - Intronic
1017041459 6:150311429-150311451 ATGGACCAATCAGCAGAACATGG - Intergenic
1017325210 6:153134335-153134357 CTCTACCAATCAGCAGGATGAGG + Intergenic
1017537514 6:155363995-155364017 CTCTACCAATCAGCAGGACGTGG + Intergenic
1017581092 6:155866351-155866373 CTCTACCAATCAGCAGGATGTGG - Intergenic
1017587018 6:155937749-155937771 CTCCACCAATGAGCCAATAATGG + Intergenic
1018064111 6:160114115-160114137 CTCTACCAATCAGCAGGATGTGG - Intergenic
1018539672 6:164864583-164864605 CCCCACCTAACAGTAGAAAATGG - Intergenic
1018545810 6:164934221-164934243 CTCTACCAATCAGCAGGACGTGG + Intergenic
1018624520 6:165764883-165764905 CTCTACCAATCAGCAGGACGTGG - Intronic
1019000145 6:168743380-168743402 CTCTACCAATCAGCAGGATGTGG - Intergenic
1019291646 7:253421-253443 CTCCTCCAGTCACCAGGAAATGG - Intronic
1019944128 7:4313417-4313439 CTCTACCAATCAGCAGGATGTGG - Intergenic
1019965616 7:4496407-4496429 CTCTACCAATCAGCAGGATGTGG - Intergenic
1020603352 7:10304532-10304554 ATCCATCAATAAGAAGAAAATGG + Intergenic
1021306325 7:19036771-19036793 CTATTCCAATCAGTAGAAAAAGG - Intronic
1021324271 7:19246483-19246505 CTCTACCAATCAGCAGGATGTGG + Intergenic
1021791942 7:24214797-24214819 CTCCCACAATCATCATAAAAAGG + Intergenic
1023128075 7:36974621-36974643 CTCTACCAATCAGCAGGACATGG + Intronic
1024118657 7:46215941-46215963 CTTCACCCAGCAGCAGAGAAAGG + Intergenic
1024269198 7:47629241-47629263 CTCTACCAATCAGCAGGATGTGG + Intergenic
1024335480 7:48202229-48202251 CTCTACCAATCAGCAGGATGTGG - Intronic
1024691382 7:51806389-51806411 CTCTACCAATCAGCAGGATGTGG + Intergenic
1024741892 7:52363371-52363393 CTCTACCAATCAGCAGGATGTGG + Intergenic
1024834186 7:53495907-53495929 CTCTACCAATCAGCAGGATGTGG + Intergenic
1025067401 7:55869246-55869268 CTCTACCAATCAGCAGGACGTGG + Intergenic
1025814803 7:64901534-64901556 CTACATCAATGAGAAGAAAAAGG - Intronic
1025961940 7:66230797-66230819 CTCTACCAATCAGCAGGATGTGG - Intronic
1026203072 7:68231796-68231818 CTCTACCAATCAGCAGGACGTGG + Intergenic
1026336017 7:69394548-69394570 CTCTACCAATCAGCAGGATGTGG + Intergenic
1026512483 7:71038478-71038500 CTCTACCAATCAGCAGGATGTGG + Intergenic
1026596442 7:71737725-71737747 CTCTACCAATCAGCAGGATGTGG - Intergenic
1027563925 7:79767610-79767632 CTCTACCAATCAGCAGGATGTGG - Intergenic
1027579549 7:79976856-79976878 CTCTACCAATCAGCAGGATGTGG - Intergenic
1027667415 7:81057079-81057101 CTCTACCAATCAGCAGGATGTGG - Intergenic
1027868239 7:83674249-83674271 CTCTACCAATCAGCAGGACGTGG + Intergenic
1028070223 7:86441332-86441354 CTCTACCAATCAGCAGGACGTGG + Intergenic
1028142612 7:87289484-87289506 CTCTACCAATCAGCAGGATGTGG + Intergenic
1028303181 7:89228365-89228387 CTCTACCAATCAGCAGGATGTGG - Intronic
1028511118 7:91627199-91627221 CTCTACCAATCAGCAGGATGTGG - Intergenic
1028852411 7:95552222-95552244 CTCTACCAATCAGCAGGATGGGG - Intergenic
1029567640 7:101349417-101349439 CTCTACCAATCAGCAGGATGTGG + Intergenic
1029599461 7:101555322-101555344 CGCCACCAAACAGCAGGCAAGGG - Intronic
1029904074 7:104072525-104072547 CTCTACCAATCAGCAGGATGTGG + Intergenic
1030366889 7:108656736-108656758 CTCTACCAATCAGCAGGATGTGG - Intergenic
1030599848 7:111581380-111581402 CTCTACCAATCAGCAGAATGTGG - Intergenic
1030733631 7:113018271-113018293 CTCTACCAATCAGCAGGATGTGG + Intergenic
1030780537 7:113594080-113594102 CTCTACCAATCAGCAGGATGTGG + Intergenic
1031292109 7:119950872-119950894 CTCTACCAATCAGCAGGACGTGG - Intergenic
1031378917 7:121060708-121060730 CTCTACCAATCAGCAGGATGTGG + Intronic
1032248186 7:130230745-130230767 CTCTACCAATCAGCAGGATGTGG + Intergenic
1032419043 7:131762933-131762955 CTCCAGCCATCAGGAGGAAATGG - Intergenic
1032561492 7:132898285-132898307 CTCTACCAATCAGCAGGATGTGG - Intronic
1033368753 7:140690620-140690642 ATACACCAGTCAGCACAAAAGGG - Intronic
1033663946 7:143423679-143423701 CTCTACCAATCAGCAGAATGTGG - Intergenic
1034091180 7:148364732-148364754 CTCTACCAATCAGCAGGATGTGG + Intronic
1034098040 7:148427171-148427193 CTCTACCAATCAGCAGGATGTGG + Intergenic
1034155151 7:148949964-148949986 CTCTACCAATCAGCAGGATGTGG + Intergenic
1034167638 7:149038336-149038358 CTCTACCAATCAGCAGGATGTGG - Intergenic
1034632017 7:152538526-152538548 CTCTACCAATCAGCAGGATGTGG - Intergenic
1034651886 7:152697835-152697857 CTCTACCAATCAGCAGGATGTGG + Intergenic
1034655907 7:152729755-152729777 CTCTACCAATCAGCAGGATGTGG - Intergenic
1034967003 7:155397951-155397973 CTCTACCAATCAGCAGTATGTGG - Intergenic
1034992093 7:155554398-155554420 CTTCAACAATTAGGAGAAAATGG - Intergenic
1036123704 8:6044657-6044679 CTCTACCAATCAGCAGGATGTGG - Intergenic
1036440916 8:8781079-8781101 CTCTACCAATCAGCAGGATGTGG - Intergenic
1036462029 8:8961833-8961855 CTGCACCAAGCTGCAGAACAAGG + Intergenic
1037241679 8:16784786-16784808 CTCTACCAATCAGCAGGATGTGG + Intergenic
1037263727 8:17036455-17036477 CTCTACCAATCAGCAGGATGTGG - Intronic
1037425487 8:18750640-18750662 CTCTACCAATCAGCAGGATGTGG - Intronic
1037431566 8:18818688-18818710 CCCCAACAACCAGCAAAAAAAGG + Intronic
1037811107 8:22087332-22087354 CTCTACCAATCAGCAGGATGAGG + Intergenic
1037983639 8:23272789-23272811 CTCTACCAATCAGCAGGATGTGG + Intronic
1038174195 8:25165376-25165398 CTCTACCAATCAGCAGGATGTGG + Intergenic
1038638411 8:29305096-29305118 CTCTACCAATCAGCAGGATGTGG + Intergenic
1038639525 8:29312185-29312207 CTCTACCAATCAGCAGGATGTGG + Intergenic
1038732335 8:30138731-30138753 CTCCTCCAGTCAGGAGAAAGAGG + Exonic
1038790012 8:30659882-30659904 CTACAGCAATCAGCTCAAAATGG + Intergenic
1039056356 8:33540268-33540290 CTGCACCAAGCTGCAGAACAAGG + Intergenic
1039061411 8:33574622-33574644 CTCTACCAATCAGCAGGATGTGG + Intergenic
1039068990 8:33633465-33633487 CTCTACCAATCAGCAGGATGTGG - Intergenic
1039637445 8:39181051-39181073 CTCTACCAATCAGCAGGATGTGG + Intronic
1040014603 8:42690276-42690298 CTCTACCAATCAGCAGGACGTGG + Intergenic
1040952566 8:52952174-52952196 CTCTACCAATCAGCAGGATGTGG - Intergenic
1040954798 8:52969430-52969452 CTCTACCAATCAGCAGGATGTGG - Intergenic
1041034530 8:53775420-53775442 CTCTACCAATCAGCAGGATGTGG - Intronic
1041914638 8:63126797-63126819 CTCTACCAATCAGCAGGATGTGG + Intergenic
1041987007 8:63933959-63933981 CATCACCAATCATCAGGAAAAGG - Intergenic
1042512428 8:69625849-69625871 CTCTACCAATCAGCAGGATGTGG - Intronic
1043102113 8:76059939-76059961 CTCTACCAATCAGCAGGATGTGG - Intergenic
1043110270 8:76170774-76170796 CTCTACCAATCAGCAGGATGCGG + Intergenic
1043129814 8:76447212-76447234 CTCTACCAATCAGCAGGACGTGG - Intergenic
1043346553 8:79304048-79304070 CTCTACCAATCAGCAGGATGTGG + Intergenic
1043352374 8:79376841-79376863 CTCTACCAATCAGCAGGATGTGG - Intergenic
1043710002 8:83403670-83403692 CTCTACCAATCAGCAGGATGTGG + Intergenic
1044075943 8:87821598-87821620 CTCTACCAATCAGCAGGATGTGG + Intergenic
1044405023 8:91817245-91817267 CTCTACCAATCAGCAGGATGTGG + Intergenic
1044558337 8:93588731-93588753 CCCCACCACCCATCAGAAAATGG + Intergenic
1044633359 8:94299980-94300002 CTCTACCAATCAGCAGGACGTGG - Intergenic
1044788832 8:95824641-95824663 CTCTACCAATCAGCAGGATGTGG + Intergenic
1044880552 8:96718684-96718706 CTCTACCAATCAGCAGGATGTGG - Intronic
1045232214 8:100316410-100316432 CTCTACCAATCAGCAGGATGTGG - Intronic
1045467638 8:102485110-102485132 CTCTACCAATCAGCAGGATGTGG - Intergenic
1046047091 8:108977117-108977139 CAACAGCAACCAGCAGAAAATGG + Intergenic
1046149231 8:110202223-110202245 CTCTACCAATCAGCAGGATGTGG - Intergenic
1046208765 8:111040436-111040458 CTCTACCAATCAGCAGGATGTGG - Intergenic
1046265257 8:111822727-111822749 CTCTACCAATCAGCAGGATGTGG - Intergenic
1046289023 8:112133456-112133478 CTCTACCAATCAGCAGGATGTGG + Intergenic
1046445463 8:114312114-114312136 CTCTACCAATCAGCAGGACGTGG + Intergenic
1047724301 8:127670817-127670839 CTGCCCCAAGGAGCAGAAAACGG - Intergenic
1048757374 8:137754718-137754740 CTCTACCAATCAGCAGGATGTGG - Intergenic
1048789323 8:138085070-138085092 CTCTACCAATCAGCAGGATGTGG + Intergenic
1049087504 8:140490035-140490057 CTCTACCAATCAGCAGGATGTGG - Intergenic
1049500453 8:142960399-142960421 CTCTACCAATCAGCAGGACGTGG + Intergenic
1050920753 9:11197789-11197811 CTCTACCAATCAGCAGGATGTGG + Intergenic
1051304949 9:15699481-15699503 CTCTACCAATCAGCAGGACGTGG - Intronic
1051383425 9:16481239-16481261 CTCTACCAATCAGCAGGATGTGG + Intronic
1051440023 9:17073735-17073757 CTCTACCAATCAGCAGGATGTGG + Intergenic
1051451638 9:17204438-17204460 CTCCAGCAAGCTGCAGAAGAGGG - Intronic
1051463922 9:17354699-17354721 CTCTACCAATCAGCAGGATGTGG + Intronic
1051892790 9:21959804-21959826 CTCTACCAATCAGCAGGATGTGG + Intronic
1052075575 9:24135830-24135852 CTCTACCAATCAGCAGGATGTGG + Intergenic
1052493217 9:29193074-29193096 CTCCACCTACCCCCAGAAAAAGG - Intergenic
1052979679 9:34438778-34438800 CTCTACCAATCAGCAGGATGTGG + Intronic
1052985200 9:34481963-34481985 CTCTACCAATCAGCAGGATGTGG - Intronic
1053027157 9:34739833-34739855 CTCTACCAATCAGCAGGATGTGG - Intergenic
1053389731 9:37725873-37725895 CTCTGCCATTCTGCAGAAAAGGG + Intronic
1053547796 9:39041995-39042017 CTCTACCAATCAGCAGCATGTGG - Intergenic
1053811890 9:41861634-41861656 CTCTACCAATCAGCAGCATGTGG - Intergenic
1054618705 9:67325805-67325827 CTCTACCAATCAGCAGCATGTGG + Intergenic
1054722579 9:68617786-68617808 CTCTACCAATCAGCAGGATGTGG + Intergenic
1055049482 9:71964258-71964280 CTCTACCAATCAGCAGGATGTGG + Intronic
1055557464 9:77489953-77489975 CTCTACCAATCAGCAGGATGTGG - Intronic
1055932507 9:81573926-81573948 CTCCCTCAATCAGCAGAAGGGGG + Intergenic
1055972948 9:81929976-81929998 CCCCAAGAATCAGTAGAAAAGGG - Intergenic
1055974701 9:81945048-81945070 CCCCAAGAATCAGTAGAAAAGGG - Intergenic
1055979737 9:81990301-81990323 CCCCAAGAATCAGTAGAAAAGGG - Intronic
1056080818 9:83092736-83092758 CTCTACCAATCAGCAGGACGTGG - Intergenic
1056294649 9:85180498-85180520 ATGCACCAATCAGCAGTAGAAGG - Intergenic
1056743876 9:89283184-89283206 CTCTACCAATCAGCAGGATGTGG + Intergenic
1056771267 9:89479937-89479959 CTCTACCAATCAGCAGGATGTGG - Intronic
1057383808 9:94590782-94590804 CTCTACCAATCAGCAGGATGTGG - Intronic
1057511267 9:95681176-95681198 CTCTACCAATCAGCAGGATGTGG + Intergenic
1057543739 9:96001316-96001338 CTCCACCAATCAGCAGGATGTGG - Intronic
1057628484 9:96700208-96700230 CTCTACCAATCAGCAGGATGTGG - Intergenic
1058174729 9:101723588-101723610 CTCTACCAATCAGCAGGACATGG - Intronic
1058235579 9:102486580-102486602 CTCTACCAATCAGCAGGATGTGG - Intergenic
1058786629 9:108394395-108394417 CTCTACCAATCAGCAGGATGTGG + Intergenic
1058799471 9:108530832-108530854 CTCTACCAATCAGCAGGATCTGG + Intergenic
1058885120 9:109317148-109317170 CTCAACCTATCACCAGAGAAGGG + Intronic
1059170575 9:112120830-112120852 CTCCAACATTCAGCAGTCAATGG - Intronic
1059771820 9:117434012-117434034 CTCTACCAAGCAGAAAAAAAAGG - Intergenic
1059810739 9:117852748-117852770 CTCTACCAATCAGCAGGATGTGG + Intergenic
1059991435 9:119869805-119869827 CTCTACCAATCAGCAGGATGTGG - Intergenic
1060091462 9:120747108-120747130 CTCTACCAATCAGCAGGACGTGG + Intergenic
1060373006 9:123092348-123092370 CACCACAAATCATCAGTAAATGG - Intronic
1060594094 9:124838213-124838235 CTCTACCAATCAGCAGGACGTGG - Intergenic
1062146085 9:134990640-134990662 CTCTACCAATCAGCAGGATGTGG - Intergenic
1203757291 Un_GL000218v1:144890-144912 TTCCATCACGCAGCAGAAAAAGG + Intergenic
1203716671 Un_KI270742v1:157565-157587 TTCCATCACGCAGCAGAAAAGGG + Intergenic
1203534541 Un_KI270743v1:20672-20694 TTCCATCACGCAGCAGAAAAAGG - Intergenic
1203650903 Un_KI270751v1:121144-121166 TTCCATCACGCAGCAGAAAAAGG + Intergenic
1186152466 X:6690027-6690049 CTCTACCAATCAGCAGGATGTGG - Intergenic
1186323139 X:8452129-8452151 CTCTACCAATCAGCAGGATGTGG - Intergenic
1186721664 X:12310805-12310827 ATCCACCTACCAGCAGAAATAGG - Intronic
1187005724 X:15231213-15231235 CTCTACCAATCAGCAGGATGTGG - Intergenic
1187139188 X:16576333-16576355 CTCTACCAATCAGCAGGATGTGG + Intergenic
1187304730 X:18084683-18084705 CTCTACCAATCAGCAGGATGTGG + Intergenic
1187452263 X:19408995-19409017 ATACACAAAGCAGCAGAAAAGGG - Intronic
1187557452 X:20366419-20366441 CTCTACCAATCAGCAGGATGTGG - Intergenic
1187904156 X:24050665-24050687 CTCTACCAATCAGCAGGATGTGG + Intergenic
1188112134 X:26205682-26205704 CTCTACCAATCAGCAGGATGTGG + Intergenic
1188129687 X:26416313-26416335 CTATTCCAATCAACAGAAAAAGG - Intergenic
1188166845 X:26873300-26873322 CTCTACCAATCAGCAGGATGTGG - Intergenic
1189752585 X:44237686-44237708 CTTAACCAATCAGCAGCAATTGG + Intronic
1190045639 X:47109818-47109840 CTCTACCAATCAGCAGGATGTGG - Intergenic
1190413807 X:50162568-50162590 CTCTACCAATCAGCAGGATGTGG - Intergenic
1191078823 X:56487256-56487278 CTCGCCCAATCAGGAGAAATGGG + Intergenic
1191091866 X:56632110-56632132 CTACTCCAATCAATAGAAAAAGG - Intergenic
1192770798 X:74187337-74187359 CTCTTCCAAGCAGGAGAAAAGGG + Intergenic
1192789791 X:74370152-74370174 CTCAAGAAATCAACAGAAAATGG + Intergenic
1193040077 X:76996096-76996118 CTCTACCAATCAGCAGGATGTGG - Intergenic
1193538005 X:82737485-82737507 CTCCACCAATCAGCAGGATGTGG - Intergenic
1193967836 X:88010528-88010550 CTATTCCAATCAACAGAAAAAGG + Intergenic
1194118017 X:89926656-89926678 CTCTACCAATCAGCAGGAGGTGG + Intergenic
1194166456 X:90522057-90522079 CTCTACCAATCAGCAGGATGTGG + Intergenic
1194650695 X:96511730-96511752 CTCTACCAATCAGCAGGATGTGG - Intergenic
1195079878 X:101360689-101360711 CTCCACAAGTGAGCTGAAAAAGG - Exonic
1195257893 X:103106745-103106767 CTCTACCAATCAGCAGGATGTGG - Intergenic
1196197810 X:112854497-112854519 CTCTACCAATCAGCAGGATGTGG - Intergenic
1196319410 X:114270126-114270148 CTCTACCAATCAGCAGGATGTGG - Intergenic
1196662385 X:118282101-118282123 CTCTACCAATCAGCAGGATGTGG - Intergenic
1196705757 X:118716293-118716315 CTCTACCAATCAGCAGGATGTGG - Intergenic
1196714778 X:118800195-118800217 CTCTACCAATCAGCAGGATGTGG + Intergenic
1196728825 X:118921622-118921644 CTCTACCAATCAGCAGGATATGG - Intergenic
1196741642 X:119030397-119030419 CTCTACCAATCAGCAGGATGTGG + Intergenic
1196761837 X:119207836-119207858 CTCTACCAATCAGCAGGATGTGG - Intergenic
1196762142 X:119209683-119209705 CTCTACCAATCAGCAGGATGTGG - Intergenic
1196771631 X:119300563-119300585 CTCTACCAATCAGCAGGATGTGG + Intergenic
1196775347 X:119332875-119332897 CTCTACCAATCAGCAGGATGTGG + Intergenic
1196775636 X:119334477-119334499 CTCTACCAATCAGCAGGATGTGG + Intergenic
1196781316 X:119386862-119386884 CTCTACCAATCAGCAGGATGTGG - Intergenic
1196793828 X:119487110-119487132 CTCTACCAATCAGCAGGATGTGG - Intergenic
1196827139 X:119750301-119750323 CTCTACCAATCAGCAGGATGTGG - Intergenic
1197000147 X:121431007-121431029 CTCTACCAATCAGCAGGATGTGG - Intergenic
1197331056 X:125155063-125155085 CTCTACCAATCAGCAGGATGTGG - Intergenic
1197344696 X:125318465-125318487 CTCTACCAATCAGCAGGATGTGG - Intergenic
1198300134 X:135326496-135326518 CTCTACCAATCAGCAGGATGTGG + Intronic
1198664187 X:139003504-139003526 CTCTACCAATCAGCAGGATGTGG - Intronic
1198872202 X:141188136-141188158 CTCTACCAATCAGCAGGATGTGG - Intergenic
1199028648 X:142971419-142971441 CTCTACCAATCAGCAGGATGTGG - Intergenic
1199050109 X:143228289-143228311 CTCTACCAATCAGCAGGATGTGG - Intergenic
1199134058 X:144230850-144230872 CTCTACCAATCAGCAGGATGTGG - Intergenic
1199175690 X:144784660-144784682 CTCTACCAATCAGCAGGATGTGG + Intergenic
1199356105 X:146866321-146866343 CTCTACCAATCAGCAGGATGTGG - Intergenic
1199359756 X:146904994-146905016 ATGAAACAATCAGCAGAAAAAGG + Intergenic
1199831166 X:151550715-151550737 CTCTACCAATCAGCAGGATGTGG - Intergenic
1200024703 X:153247519-153247541 CTCCAGCTGTCAGTAGAAAATGG - Intergenic
1200423441 Y:2997863-2997885 CTCTACCAATCAGCAGGATGCGG - Intergenic
1200470776 Y:3583690-3583712 CTCTACCAATCAGCAGGATGTGG - Intergenic
1200512725 Y:4099838-4099860 CTCTACCAATCAGCAGGATGTGG + Intergenic
1200824169 Y:7621695-7621717 CTCTACCAATCAGCAGGATGTGG - Intergenic
1200888811 Y:8299617-8299639 CTCTACCAATCAGCAGGATGTGG + Intergenic
1201170868 Y:11262511-11262533 TTCCATCACGCAGCAGAAAAAGG + Intergenic
1201422937 Y:13819844-13819866 CTCTACCAATCAGCAGGATGTGG - Intergenic
1201423454 Y:13824349-13824371 CTGCATCACTCAGCAGAGAAAGG - Intergenic
1201480062 Y:14428972-14428994 CTCTACCAATCAGCAGGATGTGG + Intergenic
1201488277 Y:14513577-14513599 CTCTACCAATCAGCAGGATGTGG + Intergenic
1201496794 Y:14597401-14597423 CTCTACCAATCAGCAGGATGTGG - Intronic
1201691889 Y:16776184-16776206 CTCAACCAAACAACAGAAGAAGG - Intergenic
1201715926 Y:17043833-17043855 CTCTACCAATCAGCAGGATGTGG + Intergenic
1202109968 Y:21408124-21408146 CTCTACCAATCAGCAGGATGTGG + Intergenic
1202136974 Y:21676302-21676324 CTCTACCAATCAGCAGGATGTGG - Intergenic
1202235888 Y:22709392-22709414 CTCTACCAATCAGCAGGATGTGG + Intergenic
1202307275 Y:23486776-23486798 CTCTACCAATCAGCAGGATGTGG - Intergenic
1202563530 Y:26183810-26183832 CTCTACCAATCAGCAGGATGTGG + Intergenic