ID: 1007989587

View in Genome Browser
Species Human (GRCh38)
Location 6:46241183-46241205
Sequence ATAAGCTATTTTGCCAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007989581_1007989587 20 Left 1007989581 6:46241140-46241162 CCACGTGCGTCTCTATTTTACCA 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1007989587 6:46241183-46241205 ATAAGCTATTTTGCCAGGCTGGG No data
1007989584_1007989587 0 Left 1007989584 6:46241160-46241182 CCATTTTCTGCTGATTGGTGGAG 0: 1
1: 0
2: 1
3: 47
4: 1017
Right 1007989587 6:46241183-46241205 ATAAGCTATTTTGCCAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007989587 Original CRISPR ATAAGCTATTTTGCCAGGCT GGG Intronic
No off target data available for this crispr