ID: 1007989959

View in Genome Browser
Species Human (GRCh38)
Location 6:46244722-46244744
Sequence ACTAAGGCCCAGAGCGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 210}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007989959_1007989963 12 Left 1007989959 6:46244722-46244744 CCTGCTTCGCTCTGGGCCTTAGT 0: 1
1: 0
2: 2
3: 30
4: 210
Right 1007989963 6:46244757-46244779 AAAATCCAGGTCAGACTCCTAGG 0: 1
1: 0
2: 1
3: 17
4: 181
1007989959_1007989961 -1 Left 1007989959 6:46244722-46244744 CCTGCTTCGCTCTGGGCCTTAGT 0: 1
1: 0
2: 2
3: 30
4: 210
Right 1007989961 6:46244744-46244766 TTTCCTTTTCTGTAAAATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007989959 Original CRISPR ACTAAGGCCCAGAGCGAAGC AGG (reversed) Intronic
900869696 1:5293198-5293220 ACAGAGGCCCAGAGGGAAGGAGG + Intergenic
902293030 1:15447393-15447415 ACTGAGGCCCAGAGAGAGGAAGG + Intronic
902374535 1:16024087-16024109 ACTGAGGCCCAGAGAGGGGCAGG - Intronic
902379476 1:16045851-16045873 ACTGAGGCCCAGAGAGGGGCAGG - Intronic
902706987 1:18212520-18212542 ACTGAGGCCCAGAGAGGAGTAGG + Intronic
902822357 1:18951059-18951081 ACCAAGGCCCAGAGGGGGGCTGG - Intronic
902930112 1:19725176-19725198 CCTAGGGCCCAGAGTGAAGCAGG + Intronic
902957657 1:19936817-19936839 ACTGAGGCCTAGAGAGGAGCAGG + Intergenic
903342036 1:22660712-22660734 ACTGAGGCTCAGAGAGAGGCAGG + Intronic
903389557 1:22954208-22954230 ACCAAGGCCCAGAGAGGGGCGGG + Intronic
903542148 1:24102460-24102482 ACTAAGGCCCAGAGAGAGGGAGG - Intronic
903620426 1:24694109-24694131 ACTGTGGCCCAGAGAGGAGCAGG - Intergenic
903648443 1:24908881-24908903 CCTGAGGCCCAGAGAGAAGAAGG - Intronic
903658048 1:24960803-24960825 ACTGAGGCCCAGAGAGAGGAAGG + Intronic
903832388 1:26182987-26183009 GCTAAGAGCCAGAGGGAAGCTGG - Intronic
903889561 1:26560552-26560574 ACTGAGGCCCAGAGAGGGGCAGG + Intronic
904461704 1:30684608-30684630 ACTGAGGCCCAGATTGAGGCAGG - Intergenic
904462803 1:30690405-30690427 AACAAGGGCCAGAGCCAAGCTGG + Intergenic
904561755 1:31402918-31402940 ACTGAGGCCAAGACCGAAGAAGG - Intergenic
904673337 1:32181898-32181920 ACTAAGACCCAGAGAGGAGAAGG - Intronic
904851541 1:33463245-33463267 ACTGAGGCCCAGACAGAAGAAGG - Intergenic
905688629 1:39926755-39926777 ACGAAGGCCCAGAGGCAAGAAGG - Intergenic
907566839 1:55443372-55443394 ACTAAGGGCCAGAGAGCAGCAGG - Intergenic
908489204 1:64626013-64626035 ACTTATGCCCAGAGCCAAACAGG - Intronic
913325614 1:117625888-117625910 ACTAAGGCTCACAGGGAAACAGG - Exonic
914764307 1:150624503-150624525 GCTAAGGCCCAGAGGTAGGCTGG + Intronic
915786096 1:158613687-158613709 ACTAAGGGTCAGACCGCAGCAGG - Intronic
915904317 1:159866651-159866673 ACTAAGGCTCAAATCAAAGCTGG + Intronic
919727085 1:200891476-200891498 ACCAAGGCCCAGAGGAAAGAGGG - Intronic
920982584 1:210852234-210852256 GCAAAGGCCCAGAGGGAAGGAGG + Intronic
921165158 1:212501893-212501915 ACCAAGGCCCAGAGAGGAGAAGG + Intergenic
921355708 1:214282284-214282306 ACTAAAGCCCAGAGAGAAAGTGG + Intronic
922243210 1:223770398-223770420 ACTATGACCCAAAGCAAAGCTGG - Intronic
923437052 1:233977182-233977204 ACACAAGCCCAGAGAGAAGCAGG - Intronic
923723133 1:236484199-236484221 ACTCAGTCACAGAGCGAATCTGG - Intronic
923933128 1:238726491-238726513 ACTGAGGCCCAGTGGGGAGCTGG - Intergenic
1067294317 10:44966166-44966188 ATTAAGGCCCAGAGAGGAGAAGG + Intronic
1068631753 10:59305131-59305153 ACTAAGACACATGGCGAAGCTGG + Intronic
1069801128 10:71082283-71082305 ACTCAGGCCCACAGCCAAGGAGG - Intergenic
1069914500 10:71779205-71779227 ACTGAGGCCCAGCACAAAGCTGG + Intronic
1070615525 10:77966765-77966787 ACTGAGGCCCAGAGGGATGTGGG + Intergenic
1070835105 10:79443092-79443114 GCTAAGGCCCAGAGAGAGACGGG + Intronic
1072189247 10:93066875-93066897 ACTGAGGCCCAGAGTGAAGAGGG - Intronic
1072413836 10:95230806-95230828 ACTGTGGCCCTGAGCCAAGCTGG + Intergenic
1073461239 10:103667131-103667153 ACCAAGGCCCAGAGAGACTCTGG + Intronic
1074249172 10:111726712-111726734 ACTGAGGCTCAGAGTGAAGAAGG - Intergenic
1074533476 10:114312503-114312525 ACTGAGGCCCAGAGGGAATGGGG - Intronic
1075080597 10:119381132-119381154 ACTAAGGTCCAGAGGGGAGGGGG - Intronic
1075469203 10:122675495-122675517 ACAAAGGGACAGAGCTAAGCAGG - Intergenic
1077285314 11:1762967-1762989 ACAAAGGCCCAGAGCAAGGGTGG + Intronic
1077369979 11:2177312-2177334 AGTCAGGCCCAGAGCGAGGCCGG + Intergenic
1077674571 11:4184819-4184841 ACAAAAGCCCAGGGAGAAGCAGG + Intergenic
1077862752 11:6198046-6198068 AGAAAGGCCCTGAGGGAAGCAGG + Intergenic
1078870610 11:15340935-15340957 ACTAATCCCCAGTGAGAAGCTGG - Intergenic
1078895565 11:15594246-15594268 TTGAAGGCCCAGAGAGAAGCTGG + Intergenic
1080061359 11:27960156-27960178 ACTAAGGCCCAGAGAGAAAAAGG - Intergenic
1080746924 11:35116493-35116515 ACTGAGGCCCAGAGGGATGAAGG - Intergenic
1081749551 11:45500146-45500168 AGAAAGGGCCAGAGGGAAGCAGG - Intergenic
1081813789 11:45927674-45927696 ACTGAGGCCCAGAAAGGAGCAGG - Intronic
1084942495 11:72620438-72620460 ACTGAGGCCCAGAGAGTAGCAGG + Intronic
1084949640 11:72657527-72657549 ACAAAGGCCCAGAGCCAAAGGGG + Intronic
1084973334 11:72782972-72782994 ACTAAGGACCAGAGAGGAGGAGG - Intronic
1085128406 11:74017641-74017663 ACCAAGGCCCAAAGAGAAGGTGG - Intronic
1085389665 11:76175956-76175978 AGGAAGGCCCACAGTGAAGCAGG + Intergenic
1085449550 11:76623697-76623719 AGTGAGGCCCAGAGACAAGCAGG + Intergenic
1085619930 11:78030418-78030440 ACTGAGGCCCAGAGAGGGGCAGG - Intronic
1086041545 11:82485612-82485634 ACTGAGGCCCAGAGAGGAGCAGG - Intergenic
1086167864 11:83800237-83800259 ACTGAGGCCCAGAGAGATGAAGG - Intronic
1087484789 11:98747888-98747910 ACTGAGGGCCAGAGGGTAGCTGG + Intergenic
1089096493 11:115923958-115923980 ACTAAGACCCAGAGAGAGGAAGG + Intergenic
1092601858 12:10075373-10075395 ACTCAGGCCCTGATCGAAACAGG + Intronic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1097287556 12:57889496-57889518 CCTGAGGCCCAGAGGGAAGCAGG + Intergenic
1100348614 12:93756521-93756543 TCTAAGGTCTAGAGCGGAGCTGG + Intronic
1101733846 12:107448103-107448125 AATGAGGCCCAGATGGAAGCGGG + Intronic
1102300427 12:111767164-111767186 ACTAAGGCCCACGGCGGCGCGGG - Intronic
1102466676 12:113134530-113134552 ACCAAGGCCCAGAGAGAAGCAGG + Intronic
1103137685 12:118521817-118521839 ACTGAGCCCCTGAGCTAAGCCGG - Intergenic
1104912431 12:132245701-132245723 GCTCAGGCTCAGAGCAAAGCCGG - Intronic
1106197944 13:27510087-27510109 ACTCAGGCCCAGAGCTAGGGTGG - Intergenic
1107939754 13:45373122-45373144 ACTAAGTCCCAAAGGGAAGAGGG - Intergenic
1112611268 13:100957116-100957138 ATTAAGGCCCACAGCAAAGTTGG + Intergenic
1115185489 14:30683527-30683549 ACAAAGGAGCAGAGCCAAGCTGG - Intronic
1120299748 14:82691563-82691585 GCTAAGGCCCAGAGGTAGGCTGG + Intergenic
1121831520 14:97056261-97056283 ACTAAGGACCAGGGCAAAGGGGG - Intergenic
1122097809 14:99384231-99384253 ATTCAGGCCCAGAGGGAGGCGGG + Intergenic
1123068238 14:105628747-105628769 AGAAAGGCCCAGAGTGCAGCAGG - Intergenic
1123072250 14:105647553-105647575 AGAAAGGCCCAGAGTGCAGCAGG - Intergenic
1123092254 14:105747071-105747093 AGAAAGGCCCAGAGTGCAGCAGG - Intergenic
1123097831 14:105774772-105774794 AGAAAGGCCCAGAGTGCAGCAGG - Intergenic
1123160276 14:106271461-106271483 ACTAAGGCCCAAAGCCAAGCAGG + Intergenic
1123178712 14:106446515-106446537 ACTAAAGCCCAAAGCCAAGCAGG + Intergenic
1125343805 15:38699047-38699069 ACTGAGGCCCAGAGCAAGCCAGG - Exonic
1127285391 15:57528488-57528510 AGTAAGGCCCAGAGGGAGGTAGG + Intronic
1128161677 15:65426797-65426819 ACTGAGGCCCAGAGAGAGGATGG - Intergenic
1129165139 15:73772794-73772816 ACTGAGGCCCAGAGAGGAGCGGG + Intergenic
1129258716 15:74350450-74350472 ACTGAGGCCCAGTGAGAAGAAGG - Intronic
1129462888 15:75708696-75708718 ACTGAGGCTCAGAGAAAAGCAGG - Intronic
1129659068 15:77543065-77543087 ACTGAGGCCCAGAGAGAGGCAGG - Intergenic
1129721989 15:77882720-77882742 ACTGAGGCTCAGAGAAAAGCAGG + Intergenic
1130912929 15:88283360-88283382 ACTGAGGTCCTGAGAGAAGCTGG - Intergenic
1132289058 15:100686577-100686599 GTCAAGGCCCAGAGGGAAGCGGG + Intergenic
1132498080 16:273244-273266 CCTTGGGCCCAGAGAGAAGCTGG + Intronic
1132789944 16:1680134-1680156 ACTAGTGCTCAGAGCGAATCCGG + Intronic
1132857524 16:2053452-2053474 GGTAAGGCCCAGGGCGACGCTGG + Exonic
1133569188 16:7024927-7024949 ACTGAGGCCCAGAGAGGAACAGG + Intronic
1136026138 16:27470182-27470204 AATGAGGCCCAGAGAGAAGAGGG + Exonic
1136685858 16:31994624-31994646 ACTGAGGCCCTGAGTGGAGCAGG - Intergenic
1137400295 16:48147604-48147626 ACAAAGGCCCAGAGAGAGGAAGG + Intronic
1138289535 16:55835197-55835219 ACTAAGGCCCAGAGATGAGGAGG + Intergenic
1138303893 16:55956906-55956928 ACTAAGGCCCAGAGAGGGGTCGG + Intergenic
1141519818 16:84571319-84571341 ACTAAGGCCCAGAGGGAGCCCGG - Intronic
1143029921 17:3962218-3962240 ACTGAGGCCCAGAGAGGAGCAGG + Intronic
1147146813 17:38490288-38490310 ACTGAGGCCCTGAGTGGAGCGGG - Intronic
1148438747 17:47701022-47701044 ACTGAGGCCCAGAGAGGGGCAGG + Intronic
1150290726 17:63980080-63980102 ACTAAGGCCCAGAGGGGACCAGG + Intergenic
1151535813 17:74738238-74738260 ACCGAGGCCCAGAGAGAGGCAGG - Intronic
1152017571 17:77761616-77761638 CATAAGGCCCAGATCGAGGCTGG - Intergenic
1152544087 17:80992095-80992117 ACTGAGGCGCAGCGCGCAGCCGG + Intronic
1152621446 17:81366891-81366913 ACTGAGACCCAGAGCGGAGAAGG - Intergenic
1154027879 18:10724984-10725006 ACTAAGACTCAAAGCGATGCAGG + Intronic
1157244004 18:46037712-46037734 ACAGAGGCCCAAAGCCAAGCAGG + Intronic
1157297906 18:46459275-46459297 ACTAAGGCCCAGAGAGACAAAGG - Exonic
1158547512 18:58408718-58408740 ACGAGGGCCCTGAGAGAAGCTGG - Intergenic
1158578453 18:58660649-58660671 TCCAAGGCCCAGAGCAGAGCTGG + Intergenic
1160798579 19:956797-956819 ACTGAGGCCCAGAGAGGGGCAGG + Intronic
1161232278 19:3180240-3180262 ACTGAGGCCCAGAGAGGGGCCGG - Exonic
1161702112 19:5801360-5801382 ACTGAGGCTCAGAGAGGAGCAGG - Intergenic
1161993407 19:7698275-7698297 ACTGAGGCCCAGAGAGGAGCGGG + Intronic
1164576394 19:29407797-29407819 ACTGAGGCCCAGTGAGAAGAAGG + Intergenic
1165095966 19:33410128-33410150 ACTAAGGCCCAGCGCGCAGTGGG + Intronic
1165793093 19:38504138-38504160 ACGAAGGCCCAGAGAGACACAGG - Intronic
1166715574 19:44965037-44965059 ACAAAGGCTCAGAGCAAAGAAGG - Intronic
1166821884 19:45585543-45585565 ACTGAGGCCCAGAGCAGGGCAGG + Intronic
1167570184 19:50281974-50281996 ACAGAGGCCCAGAGCAAAGAAGG - Intronic
1167732343 19:51267686-51267708 GCTAAGGCCCAGAGAGGAGAAGG + Intronic
925109640 2:1322899-1322921 AGGAAGGCCCAGATCCAAGCAGG + Intronic
925355403 2:3237743-3237765 ACCAAGGCTCAGAGAGATGCAGG - Intronic
929547547 2:42865571-42865593 ACTGAGGCCCAGAGAGAACGTGG + Intergenic
931040082 2:58287595-58287617 ACTGAGCCCCAGAGAGAAGCTGG - Intergenic
931895180 2:66720571-66720593 ATTAAGGCCCAGAGAGAAATGGG - Intergenic
932432430 2:71683983-71684005 ACTATGGCCCAGATGGTAGCTGG - Intronic
933433565 2:82215392-82215414 CTTAAGGCCCAGACCCAAGCGGG + Intergenic
934848200 2:97676928-97676950 ACTAAGGCCCAGATGGAAGATGG + Intergenic
937046843 2:118856195-118856217 ACTGAGGCCCAGAGAGCAGCGGG - Intergenic
937204016 2:120224207-120224229 ACTGAGGCCCAGAGAGAAAGAGG - Intergenic
937248824 2:120510853-120510875 AACAAGGCCCAGAGAGAAACAGG - Intergenic
937254731 2:120547146-120547168 ACTGAGGCCCAGAAGGAATCAGG + Intergenic
940879722 2:158934776-158934798 CCTAATGCCCAGAGTAAAGCAGG - Intergenic
947731011 2:232431653-232431675 ACTGAGGCCCAGAGACAAGAAGG - Intergenic
947929245 2:233949865-233949887 ACTAAGGTTCTGAGCCAAGCTGG - Intronic
948867330 2:240782632-240782654 GCTGAGGCCCGGAGCGAAGCTGG + Intronic
949072005 2:242030986-242031008 ACTGAGGCCCAGGGTGAAGTGGG - Intergenic
1168831335 20:846783-846805 ACTGAGGCCCAGAGGGAAACTGG - Intronic
1170602005 20:17848468-17848490 ACCAAGGCTCAGAGAGGAGCAGG - Intergenic
1172197408 20:33101401-33101423 ACTGAGGCTCAGAGTGAAGTTGG - Intronic
1172838783 20:37889419-37889441 ACTAAGGCCCAGGGAAAGGCAGG - Intergenic
1172842736 20:37911758-37911780 ACTGAGGCCCAGAGAGGGGCAGG - Intronic
1172869840 20:38129239-38129261 ACAAAGGCCCAGAGAGGAGAAGG + Exonic
1173863607 20:46300075-46300097 ACTGAGGCCCAGGGAGAGGCTGG - Intronic
1174611935 20:51804893-51804915 AGTAAGTCCTAGAGCAAAGCAGG + Intergenic
1175100992 20:56578724-56578746 ACTGAGGCTCAGAGAAAAGCAGG + Intergenic
1180205663 21:46258082-46258104 AGGAAGGCTCAGAGCAAAGCAGG + Intronic
1182120208 22:27781544-27781566 ACTGAGGCCCAGAGAGGAACTGG + Intronic
1183050082 22:35253801-35253823 ACTCAGAGCCAGAGAGAAGCAGG - Intergenic
1183314543 22:37129613-37129635 ACTGAGGCCCAGAGAGGTGCAGG - Intronic
1183563868 22:38598772-38598794 AATGAGGCACAGAGAGAAGCTGG + Intronic
1184111540 22:42398355-42398377 ACCAAGGCCCAGAGGGGAACTGG - Intronic
1184195692 22:42926281-42926303 ACTGAGGCCTAGAGCTCAGCAGG + Intronic
1185071494 22:48659168-48659190 ACGAGGGCCCAGAGTGAGGCAGG - Intronic
1185421058 22:50734623-50734645 ACTCAGGCCCAGAGCGAGTCAGG + Intergenic
950161345 3:10763433-10763455 ACTGAGGCCCAGAGTGGTGCTGG - Intergenic
950612925 3:14137563-14137585 AAAAAGGCCCAGAGCCAGGCAGG + Intronic
954416281 3:50394984-50395006 ACTTAGGCCCAGAGGGTGGCCGG - Intronic
958454441 3:94312068-94312090 AATAAGGGACAGAGAGAAGCAGG + Intergenic
961465467 3:127078490-127078512 ACTAAGGCCCAGAGAGGAGAAGG + Intergenic
962400143 3:135051319-135051341 ACCCAGGCCCAGAGCAAAGGTGG - Intronic
962606428 3:137036188-137036210 ACTGAGGCCCAGAGAGATGGGGG + Intergenic
962967124 3:140365594-140365616 ACTAAGGCCCAGAGAGGTGAGGG + Intronic
963079708 3:141379465-141379487 ACTAAGGCACAGTTGGAAGCTGG - Intronic
964898154 3:161622981-161623003 ACAAAGGCCCAGAGCTGAGCTGG + Intergenic
967316373 3:188154638-188154660 GCTGAGGCCCAGAGAGAAGGAGG + Intronic
967387762 3:188927897-188927919 ACTAAGGCCCAGGGAGGAGATGG + Intergenic
969167593 4:5330117-5330139 ACTGAGGCCCAGAGGGAAGAAGG - Intronic
969567351 4:7986352-7986374 ACCGAGGCCCCGAGGGAAGCTGG + Intronic
976066426 4:81193090-81193112 AATAAGGCTCAGTGCAAAGCTGG + Intronic
979611957 4:122698620-122698642 AATGAGGCCCAAAGCAAAGCAGG + Intergenic
983817434 4:172149548-172149570 ACAGAGGCCCAGAGATAAGCAGG - Intronic
986988202 5:13522630-13522652 ACTGAGGCCCAGAGGGAGCCAGG - Intergenic
995341917 5:111070370-111070392 CCCAAGGACCAGAGCGATGCAGG + Intronic
998147811 5:139740226-139740248 GCTAAGGCTCAGAGTGAAGCAGG - Intergenic
998154443 5:139776403-139776425 CCTGAGGCCCAGAGAGGAGCAGG + Intergenic
998458079 5:142289208-142289230 ACTGAGGGCCAGAGTAAAGCTGG - Intergenic
999242793 5:150137319-150137341 ACTAAGGCACAGAGAGAGTCTGG - Intronic
999370350 5:151051493-151051515 ACTGAGGCCCAGGGAGAGGCAGG - Intronic
999749408 5:154615747-154615769 ACTGGGACCCAGAGAGAAGCAGG - Intergenic
1001419248 5:171574246-171574268 ACTGAGGCCCAGAGACAAGAAGG - Intergenic
1001562162 5:172676992-172677014 ACTGAGGCCCAGAGAAAGGCAGG + Intronic
1002199736 5:177521007-177521029 GCTTAGGCCCAGAGAGGAGCTGG + Intronic
1003573482 6:7271241-7271263 CCTAAGGCCCAGAGCAGGGCAGG + Intronic
1007391656 6:41552927-41552949 ACTGAGGCCCAGAGAGAAGACGG - Intronic
1007989959 6:46244722-46244744 ACTAAGGCCCAGAGCGAAGCAGG - Intronic
1015509575 6:134024395-134024417 ATCAAGGCACAGAGGGAAGCTGG - Intronic
1017134884 6:151139644-151139666 GCTGAGGCCCTGTGCGAAGCTGG + Intergenic
1019492810 7:1323056-1323078 ACTGAGGCCCAGAGAGGCGCAGG + Intergenic
1019557130 7:1638151-1638173 ACTGAGGCCAAGAGAGAGGCAGG + Intergenic
1019712173 7:2522732-2522754 ACTGAGGCCCAGAGAGGTGCAGG - Intronic
1019998934 7:4743752-4743774 CCTCAGGTCCAGAGAGAAGCAGG + Intronic
1021217214 7:17931641-17931663 GCTAAGGTCAAGAGCAAAGCTGG + Intronic
1021908344 7:25358974-25358996 CTTAAGGCCTAGAGAGAAGCAGG + Intergenic
1023790317 7:43748770-43748792 ACTAAAGCCAAAAGGGAAGCTGG + Intergenic
1024088769 7:45918780-45918802 ACTAAGACCCAGAGAGGAGAGGG - Intronic
1029436479 7:100566747-100566769 GCAAAGGCCAGGAGCGAAGCGGG - Exonic
1036768383 8:11563212-11563234 AGTGAGTCCCAGAGCGAAGACGG + Intronic
1038426655 8:27468324-27468346 GCTGAGGGCCAGAGGGAAGCAGG - Intronic
1042216408 8:66432814-66432836 ACTGAGGCCCAGAGAGGACCTGG + Intronic
1045810693 8:106216654-106216676 ACTGAGGACAAGAACGAAGCTGG - Intergenic
1046893084 8:119444458-119444480 ACTAAGGCCCAGAGAGAATAAGG - Intergenic
1047363808 8:124194108-124194130 ACTAAGGTCCAGAGAGATGAAGG + Intergenic
1047520720 8:125593657-125593679 ACTGAGGCCCAGAGAGATGAAGG + Intergenic
1049203009 8:141350985-141351007 ACTGAGGCCCAGAGAGGGGCAGG + Intergenic
1049572796 8:143377558-143377580 ACTGAGGCCCAGAGGGAGGGAGG + Intronic
1051342065 9:16120931-16120953 AGTAAGGCCGAGGGCTAAGCAGG + Intergenic
1053100634 9:35369386-35369408 ACCAAGGCCCAAAGTGAAGAAGG + Intronic
1053303868 9:36970326-36970348 ACAAAGGCCCTGAGAGAAGGGGG + Intronic
1053419550 9:37968841-37968863 ACTAAGGCTCAGAGTGGAGAAGG - Intronic
1053476610 9:38386450-38386472 ACTGAGGCCCAGAGGGAGGTAGG + Intergenic
1054712455 9:68524890-68524912 ACTAAAGCCCAGTGCGACACAGG - Intronic
1057793144 9:98137361-98137383 ACTAAGGCCCATAGAGAGGAGGG + Intronic
1057899072 9:98933609-98933631 ACTCATGCCCAGAGAGAAGAAGG - Intergenic
1058054175 9:100433195-100433217 ACTGAGGCTCAGAGCAAAACAGG - Intronic
1059307935 9:113369299-113369321 AATAAGGCCCAGAGAGAAAAAGG - Intronic
1059308130 9:113370532-113370554 ACTAAGGCCCAGGGAGTAGTAGG - Exonic
1059433255 9:114262265-114262287 ACTGAGGCCCAGAGAGGAGATGG + Intronic
1061141242 9:128768475-128768497 ACTGAGGCCCAGAGAGGAGATGG + Intronic
1061390463 9:130314864-130314886 ACTGAGGCCCAGAGTGAGGATGG + Intronic
1062150100 9:135013781-135013803 TCTAAGGGCCAGAGGGAAACAGG - Intergenic
1062395212 9:136350041-136350063 ACTGAGGCCCAAAGAGAGGCGGG - Intronic
1192236359 X:69298676-69298698 ACTAAGGCCCAGGGGGAGGAAGG + Intergenic
1194845371 X:98800832-98800854 ACTAAGGCCCAAAGCAAATGGGG + Intergenic
1198018645 X:132636610-132636632 ACTGAGGCCCAGAGAGAGACAGG + Intronic
1198805935 X:140494737-140494759 ACTGAGGCCCAGAGAGACACAGG - Intergenic
1199700953 X:150375175-150375197 ACTGAGGCCCAGAGAGGAGCAGG + Intronic