ID: 1007991658

View in Genome Browser
Species Human (GRCh38)
Location 6:46262331-46262353
Sequence CAGGGTGAACAGGGGGCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 512
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 468}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007991658_1007991670 23 Left 1007991658 6:46262331-46262353 CCATCAGCCCCCTGTTCACCCTG 0: 1
1: 0
2: 3
3: 40
4: 468
Right 1007991670 6:46262377-46262399 ATGACTGCACTTGGTCTCCCTGG No data
1007991658_1007991663 -8 Left 1007991658 6:46262331-46262353 CCATCAGCCCCCTGTTCACCCTG 0: 1
1: 0
2: 3
3: 40
4: 468
Right 1007991663 6:46262346-46262368 TCACCCTGCCATCAATTTTGTGG 0: 1
1: 0
2: 1
3: 12
4: 139
1007991658_1007991667 14 Left 1007991658 6:46262331-46262353 CCATCAGCCCCCTGTTCACCCTG 0: 1
1: 0
2: 3
3: 40
4: 468
Right 1007991667 6:46262368-46262390 GCTTACCCTATGACTGCACTTGG 0: 1
1: 0
2: 0
3: 9
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007991658 Original CRISPR CAGGGTGAACAGGGGGCTGA TGG (reversed) Intronic
900078233 1:835127-835149 GTGGGTGAACAGGGGGTGGAGGG - Intergenic
900385019 1:2406571-2406593 CAGGGTGCACAGGGGGTTTCTGG + Exonic
900494203 1:2969114-2969136 CATGGTGAAGAAGGGGCTCACGG + Intergenic
900973734 1:6005373-6005395 GAGGGTGAACTGGGGGATGTGGG + Intronic
901234634 1:7661351-7661373 GAGAGTGGACAGGAGGCTGAGGG - Intronic
901601086 1:10423867-10423889 CATGCTGAACAGCGTGCTGAAGG - Intergenic
901638462 1:10681236-10681258 CAGGGTGAGGATGGGGATGAGGG - Intronic
902237040 1:15064161-15064183 CAGAGTGAGGAGGGGGCTGCAGG + Intronic
902330942 1:15731024-15731046 CAGGGTGAAGAAGGGCCTGGGGG - Intronic
902408181 1:16197949-16197971 AAGGGTGACCAGGGGGCAGGGGG - Intronic
903295967 1:22343188-22343210 CAGGGTGGACAGGGAGACGATGG + Intergenic
903796064 1:25929788-25929810 GAGGATGAGTAGGGGGCTGATGG - Intergenic
904566629 1:31432066-31432088 CAGGGTGGACAGGGTGGTTAGGG + Intronic
905819925 1:40980890-40980912 CAGGGTGAACAGGCAGGTGCAGG - Intronic
906140218 1:43530005-43530027 GAGGGTGAACATGAGGATGAAGG + Intronic
906688887 1:47779760-47779782 CAGGATGAACAGGGAGCAGTAGG - Intronic
908044097 1:60149501-60149523 CAGTGTGAACTGGGGACTGGAGG + Intergenic
909344747 1:74572094-74572116 CAGGGAGAATAGGGCCCTGAAGG - Exonic
911133415 1:94414500-94414522 CAGTGTGTAGAGTGGGCTGAAGG - Intergenic
912008572 1:104932829-104932851 GAGGGAGGCCAGGGGGCTGAAGG + Intergenic
912401540 1:109397709-109397731 CGGGGTGAGCTGGGGGCTGCGGG - Exonic
912450941 1:109767370-109767392 CAGGGTGAACAGGATGATGATGG - Intronic
913605939 1:120465975-120465997 CAGGCTCAACAGCGTGCTGATGG + Intergenic
913989283 1:143595440-143595462 CAGGCTCAACGGGGTGCTGATGG - Intergenic
914367679 1:146994329-146994351 CAGGCTCAACAGCGTGCTGATGG + Exonic
914636148 1:149554492-149554514 CAGGCTCAACAGCGTGCTGATGG + Intergenic
916286696 1:163113389-163113411 CAGTGTCATCAGTGGGCTGAGGG - Intronic
917523128 1:175764389-175764411 AAGGGTGAAAAGGGGGCTCTTGG - Intergenic
917605231 1:176621424-176621446 CAGGGTGCCAAGGGGGATGATGG - Intronic
919761612 1:201101696-201101718 CAGGATGAACAGGGGGATCTGGG + Intronic
919779607 1:201213479-201213501 CAAGGTGACCAGGGGGCTCCCGG - Exonic
920107392 1:203563623-203563645 CAGGAGGAGAAGGGGGCTGAGGG - Intergenic
920364026 1:205438680-205438702 CTGGGTGAAGAAGGGGCTGCCGG + Intronic
920394133 1:205631690-205631712 CAGCGTGAGGAGGAGGCTGAGGG - Exonic
920682660 1:208084604-208084626 CAGCATGAACAGGGGACAGATGG - Intronic
920743192 1:208600638-208600660 CAGGGTGACCAGTGCTCTGATGG + Intergenic
922455449 1:225770442-225770464 CAGGGGGAAGAGGGGTGTGATGG - Intergenic
922784873 1:228277855-228277877 AAGGGTGAGGTGGGGGCTGAGGG + Exonic
923654295 1:235901797-235901819 CACAGTAAAGAGGGGGCTGAAGG + Intergenic
924786369 1:247203633-247203655 CAGGATGAACAGCAGGCTGCTGG + Intergenic
924787336 1:247210647-247210669 CGAGGTGGGCAGGGGGCTGATGG - Intergenic
1062803310 10:395963-395985 CAGGGTCCACATGGGGATGAGGG - Intronic
1063754770 10:8995159-8995181 CTGGGTGAACTGGTGGCTGAGGG - Intergenic
1064128683 10:12688237-12688259 CTGGGTGAACACGTGGCTTATGG + Intronic
1064133008 10:12726920-12726942 CTGGGAGCACAGGGGCCTGAGGG - Intronic
1064605723 10:17036593-17036615 CAGGGCTGCCAGGGGGCTGAAGG + Intronic
1065814875 10:29474206-29474228 CAGGGAGAAAAGGGATCTGAGGG + Intronic
1065990093 10:31000606-31000628 CTGGGTGAACAGTGGGCTACAGG - Intronic
1066084127 10:31960359-31960381 AAGGATGAACAGGGGGCCCACGG - Intergenic
1067274050 10:44818982-44819004 CAGGGTGAGCAGGGGTCAGAAGG + Intergenic
1067770403 10:49118677-49118699 CAGGGAGAAGACGGTGCTGAAGG - Intergenic
1068617260 10:59132808-59132830 CAGGGAGAACAGGGCACAGAGGG + Intergenic
1069333257 10:67318579-67318601 CAGAGTGAACATGGAGATGAAGG - Intronic
1069628802 10:69884586-69884608 CAGAGTGAAAAGGGAGCCGAAGG - Intronic
1069635397 10:69921879-69921901 CAGGGTGAGAAGGGGGCTGAAGG + Exonic
1069692634 10:70363946-70363968 CAGGGAGGAGAGGGGGCTGGAGG - Intronic
1069958925 10:72068315-72068337 AAGGTGGAACAGGGGACTGAGGG + Intronic
1070331629 10:75421665-75421687 CAGGGTGGACAGGGTGATTAGGG + Intergenic
1071980689 10:91001995-91002017 CAGGGTGCACAGGCAGCTGAAGG + Intergenic
1072038607 10:91586800-91586822 TAGGTTGAACATGGGGCTGGGGG - Intergenic
1073098185 10:100993168-100993190 CCTGGGGAACAGGGGGCAGAAGG - Exonic
1073119489 10:101112926-101112948 CAGGGCGACGTGGGGGCTGAGGG - Intronic
1074057300 10:109934047-109934069 CAGGGTGAGCAGGAAGCTGTGGG + Intergenic
1074211153 10:111336378-111336400 CTGGGTGAATATGGGGCTAATGG + Intergenic
1076196073 10:128519310-128519332 CGGGGTGAAGTGGGGGCTGTAGG - Intergenic
1076389378 10:130086947-130086969 CAAGGGGCGCAGGGGGCTGAAGG + Intergenic
1076495870 10:130897594-130897616 CAGGTGGAACAGAGAGCTGAAGG - Intergenic
1076608867 10:131707915-131707937 CAGGGGGATCAGTGGGCAGAGGG + Intergenic
1077338164 11:2014578-2014600 CAGAGGGCACAGGGAGCTGAGGG - Intergenic
1077473354 11:2775145-2775167 CAGGCTGAGCAGGGGTTTGATGG - Intronic
1077478719 11:2803110-2803132 CAGAGTGAGCAAGGGGCTCAGGG + Intronic
1077498723 11:2899248-2899270 AAGGGTGTACAGTGGGGTGACGG - Intronic
1077840430 11:5968375-5968397 CAGGAGGAAGAGGAGGCTGAGGG + Exonic
1078025891 11:7695389-7695411 CAGGGTGAACTCAGGGTTGAGGG + Intronic
1078040774 11:7860936-7860958 CAGAGGGAACAGCAGGCTGAGGG + Intergenic
1079696175 11:23484566-23484588 CAGGGGGAAGAGGTGGCTGTGGG + Intergenic
1080231088 11:30017727-30017749 CAGGGTGGGCCAGGGGCTGAGGG + Intergenic
1081206722 11:40284115-40284137 CAGGGAGATCAGTGGGCTTAGGG + Intronic
1081678568 11:44985880-44985902 CAGGGAGAACTTGGGGCTGGAGG + Intergenic
1081727247 11:45339121-45339143 CAGGTTGAGCAGGGAGCAGAGGG + Intergenic
1083146068 11:60759863-60759885 CAGGGTGAACAGGGTGATGGTGG - Intronic
1083997802 11:66280694-66280716 CAGGGTCCACAGGGAGCAGAAGG - Intronic
1084153549 11:67302183-67302205 CTGGGTGGACCGGGGGCTGGGGG - Exonic
1085255443 11:75170077-75170099 ATGTGTGAGCAGGGGGCTGAGGG - Intronic
1085800452 11:79584688-79584710 CAGTGAGGACAGGGGGCTGTGGG - Intergenic
1088861743 11:113806655-113806677 CAGGCTGAACAGAGTGCTAAAGG + Intronic
1088895195 11:114073127-114073149 CTGGGTGACCAGGGGGCTCATGG + Intronic
1089085661 11:115815026-115815048 CAGGGGGAACTGGAGGCTCAAGG + Intergenic
1089176439 11:116552180-116552202 CAGGGTGAAGAGGGTGCAGGTGG - Intergenic
1089248252 11:117137978-117138000 CAGGGTGACCTGCGGGGTGAAGG + Intergenic
1089258459 11:117206583-117206605 CAGGGTGACCTGCGGGGTGAAGG - Intronic
1089846725 11:121464615-121464637 CAGGGCACGCAGGGGGCTGAGGG + Intronic
1090331483 11:125935763-125935785 CAGGAGGAGCAGGGGCCTGAAGG + Intergenic
1090848156 11:130547277-130547299 CAGCAGGAACAGGAGGCTGAAGG - Intergenic
1090872168 11:130758226-130758248 GAGGGTGAAGAAGGGGTTGAGGG + Intergenic
1091156966 11:133383075-133383097 CAGGGTGACCAGGAGGATGTTGG - Intronic
1202821148 11_KI270721v1_random:69760-69782 CAGAGGGCACAGGGAGCTGAGGG - Intergenic
1091391579 12:129407-129429 CAGGGAGAACAGGAAGCTGGAGG - Intronic
1092073554 12:5653874-5653896 CGGGATGAAAAGGGGGATGAGGG + Intronic
1093071366 12:14709586-14709608 AAGGGTGAAGAAGGGGTTGAGGG + Intergenic
1093786269 12:23195327-23195349 CCGGGTGAACAAGGGGGTGCTGG + Intergenic
1095145619 12:38722493-38722515 CAGGTTGAAGAAGGGGTTGAGGG - Intronic
1096577247 12:52560493-52560515 AAGGCTGAAAAGGGGACTGAGGG - Intergenic
1096789804 12:54037614-54037636 CAGGGTGGAGAGGGGGGAGAGGG - Intronic
1096896958 12:54830665-54830687 CAGAATGAACAGAGGGATGAAGG - Intronic
1099851219 12:88099750-88099772 GAGGGAAAACAGGAGGCTGAGGG + Intronic
1100981546 12:100166385-100166407 CTGGGTGAGCACGTGGCTGATGG + Intergenic
1101889895 12:108703844-108703866 CAGGAGGAACAAGGGGCTGGAGG - Intronic
1101904470 12:108814614-108814636 CAAGATGAGCAGGGGCCTGATGG - Intronic
1102203473 12:111074552-111074574 CAGCTTGGACAGGGGGCTGAGGG + Intronic
1102718926 12:114999700-114999722 CAGGGTCAGCAGGGTGGTGAGGG - Intergenic
1103239781 12:119403590-119403612 CAGGGGGAAGATGGGGCTGAGGG - Intronic
1103397466 12:120619125-120619147 GAGGGGGAAGAGAGGGCTGAAGG - Intergenic
1103793146 12:123485719-123485741 CAGGGTGAACCGGGGGCGGTTGG + Exonic
1104142613 12:126003400-126003422 CAGGCTGAACAGGTCGCAGATGG + Intergenic
1104906189 12:132214663-132214685 CAGGCTGGACAGGAGGCAGAGGG - Intronic
1104972742 12:132539366-132539388 CTGGGTGGACATGGGGCTGGAGG - Intronic
1104972752 12:132539395-132539417 CTGGGTGGACATGGGGCTGGAGG - Intronic
1106308229 13:28532295-28532317 CAGGGTGGACAGCGGGCGGGTGG - Intergenic
1107665400 13:42683920-42683942 CAGTGTGATCATGGAGCTGAAGG + Intergenic
1111253556 13:85638396-85638418 AAGGGTGAGCAGGGTGGTGAGGG + Intergenic
1111347263 13:86974760-86974782 GAGGGAGGCCAGGGGGCTGAAGG + Intergenic
1112333932 13:98498714-98498736 CAGGGTGTACAGTGGGGAGACGG - Intronic
1113611135 13:111645724-111645746 CAGGCTGAGCAGGGGGCTGATGG + Intronic
1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG + Intronic
1114496747 14:23138076-23138098 CAGAGTGAAGTGGGAGCTGAGGG - Intronic
1115243667 14:31273535-31273557 CTGGGTGACCGGGGGGCTCATGG + Intergenic
1115348338 14:32366201-32366223 CAGGATGAACAGGGGAATTATGG - Intronic
1116918473 14:50548278-50548300 TAGGGTGTACAATGGGCTGAGGG - Intronic
1118909164 14:70046835-70046857 CAGGGTGAACTGTGGACTCAAGG + Intronic
1119316973 14:73704400-73704422 AAGGGTGAAGAAGGGGTTGAGGG - Intergenic
1119508952 14:75196369-75196391 CAGGGTCACCTGGGGGCTGTGGG - Intergenic
1120702901 14:87717496-87717518 CAGAGTGAACTGGGAGGTGAGGG - Intergenic
1121329665 14:93041906-93041928 TATGGTTAACAGGGGGCTGCAGG - Intronic
1121406978 14:93725105-93725127 CAGGGTGAGGAGGGGGCCCAGGG + Intronic
1121494351 14:94381675-94381697 CAGAGTGGACAGGGGCCTCAGGG + Intronic
1121716783 14:96081977-96081999 CAGGGTGACCTGGGGGGCGAGGG - Intronic
1122070727 14:99203967-99203989 CTGGGGGACCTGGGGGCTGATGG - Intronic
1122687719 14:103518013-103518035 CGAGGTGAACACAGGGCTGAGGG - Intergenic
1122849027 14:104516705-104516727 CAGGGTAGGCAGGAGGCTGAGGG + Intronic
1122886398 14:104712327-104712349 CAGGGTGCACAGTGGGGTGCCGG + Intronic
1122980652 14:105191111-105191133 CAGGGAGAACAGGTCGCTGGAGG - Intergenic
1122983680 14:105202687-105202709 CAAGGTGAACAGACGGCTGGAGG - Intergenic
1123088927 14:105733183-105733205 CAGCGTGAACAGGGTGATGATGG - Intergenic
1123402527 15:20002802-20002824 CATGGTGAGCAGGGGGAAGAAGG + Intergenic
1123511865 15:21009456-21009478 CATGGTGAGCAGGGGGAAGAAGG + Intergenic
1124342749 15:28900738-28900760 CAGGGTGAAGAGGCTGCAGATGG - Intronic
1124375008 15:29124211-29124233 CAGGCTGGACACTGGGCTGAGGG + Intronic
1125514413 15:40309669-40309691 CAAAGTGGAGAGGGGGCTGATGG - Intergenic
1125520953 15:40347593-40347615 AAGGGTGACTAGGAGGCTGAGGG + Intergenic
1125521023 15:40347891-40347913 CTGGGGGAAGAGGGGGCTGCGGG + Intergenic
1125750400 15:42023859-42023881 CAAATTGAATAGGGGGCTGATGG + Intronic
1126181583 15:45790760-45790782 CAGACTGAACAAGGGGCAGATGG - Intergenic
1126915070 15:53457289-53457311 CTGGGGGAACAGGGGGCAGGTGG - Intergenic
1128056362 15:64702827-64702849 CCGGCTGAAGAGGGGGCTAAAGG + Intronic
1128072473 15:64806508-64806530 CAGGCTGGACTGGGGGCTGGGGG - Intergenic
1129270396 15:74416556-74416578 CAGGGTGAGCAGGGGCGTGAGGG - Exonic
1130032236 15:80326746-80326768 CAGAGTGAATGGGAGGCTGAGGG + Intergenic
1130486719 15:84402233-84402255 CGGGGTACACAGGGGTCTGAGGG + Intergenic
1131512230 15:93055757-93055779 CAGGGTGAGCAGGGGCTCGACGG + Intronic
1131568345 15:93506567-93506589 GAGGGAGACCAGGGGGCTGAGGG - Intergenic
1132592961 16:734357-734379 CAGGGGGCACACGGGGCTGGCGG + Intronic
1132804869 16:1770824-1770846 CAGGCTGAACAGGGGGAGGCCGG + Intronic
1133062268 16:3182857-3182879 CAGGGAGAAGCGGGGGCTCAGGG - Intergenic
1133423999 16:5671846-5671868 CAGTGTGAGCTGGGGGTTGAAGG + Intergenic
1133493416 16:6293886-6293908 CAGGGTGAGCGGGGGGGTGGTGG + Intronic
1134042821 16:11081303-11081325 TAGAGTGGAGAGGGGGCTGAGGG - Intronic
1134241453 16:12509873-12509895 CAGGGAGAACAGGGACATGAGGG - Intronic
1134628413 16:15739431-15739453 CATGGTGATCAGGGCTCTGAAGG - Intronic
1135738627 16:24954510-24954532 AGGGGTGGACAGGGGGCTGGCGG + Intronic
1138350803 16:56345342-56345364 CAGGGAGAACAGAGGGCTTGAGG - Exonic
1138383198 16:56617815-56617837 CTGGTTGATCAGGGGGCTGCTGG + Intergenic
1138439481 16:57025588-57025610 CAGGGTTAACAAGGGCCCGAGGG + Exonic
1139039551 16:62984224-62984246 AAGGGTGAAGAAGGGGTTGAGGG + Intergenic
1139039568 16:62984285-62984307 AAGGGTGAAGAAGGGGTTGAGGG + Intergenic
1139039585 16:62984346-62984368 AAGGGTGAAGAAGGGGTTGAGGG + Intergenic
1139039602 16:62984407-62984429 AAGGGTGAAGAAGGGGTTGAGGG + Intergenic
1139039651 16:62984593-62984615 AAGGGTGAAGAAGGGGTTGAGGG + Intergenic
1139347606 16:66314319-66314341 CTGGGGGAACTGGAGGCTGATGG - Intergenic
1140758547 16:78090689-78090711 CTGGGTGAATAGGGTGGTGATGG + Intergenic
1141619594 16:85229873-85229895 CAGGGTGAGAAGGGGGTAGAGGG + Intergenic
1141797465 16:86285053-86285075 GAGGTTGAACAGGGAGCCGATGG - Intergenic
1141894172 16:86947842-86947864 CAGGGTGAGAAGGTGGGTGAAGG - Intergenic
1142122668 16:88394739-88394761 CTGAGGGAACAGGGGGCTCAGGG + Intergenic
1142178867 16:88657615-88657637 CAGGGCGGGCAGGGTGCTGACGG - Intronic
1142216034 16:88830425-88830447 CAGAGTCAACATGGGGCTCATGG - Intronic
1142359259 16:89619049-89619071 CAGGGGGGGCAGGGGGCTGCAGG - Intronic
1142359396 16:89619352-89619374 CAGGGGGGGCAGGGGGCTGCAGG - Intronic
1142359411 16:89619383-89619405 CAGGGGGGGCAGGGGGCTGCAGG - Intronic
1142359495 16:89619573-89619595 CAGGGGGACCAGGGGGCTGCAGG - Intronic
1142359513 16:89619613-89619635 CAGAGGGAGCAGGGGGCTGCAGG - Intronic
1142495671 17:305131-305153 CAGGGTCATCAGGGTGCTTAGGG + Intronic
1142501412 17:335262-335284 CAGGGTGAACAGTGGGAAGGAGG + Intronic
1143001025 17:3795114-3795136 CAGGGTGCTGAGGGGGCTCAGGG - Intronic
1143166518 17:4899773-4899795 CAGGGTGTCCAGGGAGCTGGGGG - Exonic
1143167185 17:4902639-4902661 CAGGGTGACCTTGAGGCTGATGG + Exonic
1143272407 17:5685524-5685546 CATGGTGAAGAGGAGGCTGGAGG + Intergenic
1143757246 17:9075971-9075993 AAGGGTGAACCTGGGGTTGAGGG - Intronic
1144348124 17:14368296-14368318 CAGGGTTTACATGGGGCTAAGGG + Intergenic
1144420918 17:15097818-15097840 GAGGGGGAAGAGGGGGCTGATGG - Intergenic
1144701472 17:17343659-17343681 CAGGCTGCACAGGGAGCTCAGGG - Intronic
1144778304 17:17795799-17795821 CCAGGTGAAGAGGGGCCTGATGG + Exonic
1145118131 17:20231104-20231126 CAAGGAGAACAAGGGGCTGCAGG + Intronic
1145170321 17:20650883-20650905 CAAGGAGAACAAGGGGCTGCAGG + Intergenic
1145274524 17:21421807-21421829 CCGGGTGGAGAGTGGGCTGAAGG - Intergenic
1145301709 17:21645571-21645593 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1145312378 17:21707706-21707728 CTGGGTGGAGAGTGGGCTGAAGG - Intergenic
1145328017 17:21848132-21848154 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1145348601 17:22057753-22057775 CAGAGTGTAAAGGGGGCAGAAGG - Intergenic
1145694822 17:26779516-26779538 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1145901763 17:28494521-28494543 CAGGCTGAGGAGGGGGCTGGGGG - Intronic
1146122456 17:30207732-30207754 CAGGAGAAACAGAGGGCTGATGG + Exonic
1147007312 17:37413942-37413964 GAGGGTGAACAGTGGGAGGAGGG - Intronic
1147125068 17:38361755-38361777 ACCTGTGAACAGGGGGCTGAAGG - Exonic
1147376770 17:40027205-40027227 CAATGTGAACATAGGGCTGAAGG + Intronic
1147544968 17:41394062-41394084 CAGGGTGTGCAGGGGGCAGGAGG + Exonic
1147556929 17:41485632-41485654 CAGGGAGAGCAGGGAGGTGAAGG - Intergenic
1148114919 17:45169907-45169929 CAGGGCGCACAGGGTGTTGACGG - Exonic
1148240724 17:45997986-45998008 AAGGGTGAAGAGGAGGCTGGGGG + Intronic
1148572299 17:48679846-48679868 GAGGGTGGACACGGGACTGAAGG - Intergenic
1148581212 17:48745249-48745271 CAGGGTCTGCAGGGAGCTGAGGG - Intergenic
1149850032 17:60028681-60028703 CAGGGTGCTCAGGGGCCTGCCGG + Intergenic
1149860135 17:60117843-60117865 CAGGGTGCTCAGGGGCCTGCCGG - Intergenic
1151163846 17:72187782-72187804 CAGGGTGAGCAGGCGGGGGAAGG - Intergenic
1151656155 17:75496981-75497003 CAGAGGGAACAGGGGCCGGAGGG - Intronic
1151765324 17:76130769-76130791 CAGGGTGAACCGGAGGGTGTGGG - Intergenic
1151937312 17:77270522-77270544 CAGGAAAAACAGAGGGCTGAGGG - Intergenic
1152228854 17:79104803-79104825 CAGGGGGAAAATGGGGTTGAGGG + Intronic
1152566188 17:81101401-81101423 ATGGGTGAACAGGGGCCTGCTGG - Intronic
1152603784 17:81278785-81278807 CAGGGTGTATTGGGGGCTGGGGG - Intronic
1152818576 17:82423945-82423967 CAGGGGGAGCAGGGCTCTGAAGG - Intronic
1152876736 17:82790617-82790639 CAGGGTGCACAGGGGTCCCACGG - Intronic
1152940879 17:83172458-83172480 CTGGGTGAGCAGTGGGGTGAGGG + Intergenic
1152940891 17:83172496-83172518 CTGGGTGAGCAGTGGGGTGAGGG + Intergenic
1152940970 17:83172796-83172818 CTGGGTGAGCAGTGGGGTGAGGG + Intergenic
1152941026 17:83172984-83173006 CTGGGTGAGCAGTGGGGTGAGGG + Intergenic
1152941044 17:83173060-83173082 CTGGGTGAGCAGTGGGGTGAAGG + Intergenic
1152941077 17:83173173-83173195 CTGGGTGAGCAGTGGGGTGAGGG + Intergenic
1152941131 17:83173363-83173385 CTGGGTGAGCAGTGGGGTGAGGG + Intergenic
1203192637 17_KI270729v1_random:204353-204375 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1203202004 17_KI270730v1_random:3788-3810 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1153784880 18:8525906-8525928 CAGGGAGAGAAGGGGGCTGTGGG - Intergenic
1155916734 18:31564863-31564885 CAGAGAGAACAGGTGGCTCAGGG + Intergenic
1156460536 18:37319131-37319153 CCGTGTGAACTGGGGGCTGCAGG + Intronic
1157546323 18:48549146-48549168 CAGGGTGCACATAGGGGTGATGG + Intronic
1157869718 18:51218775-51218797 CAGGAAGAACAGGAGGCTAAGGG + Intergenic
1159164275 18:64682687-64682709 AAGGGTGAAGAAGGGGTTGAGGG - Intergenic
1160136284 18:76274340-76274362 CAGGGCAACCAGGGGGCTGAGGG + Intergenic
1160239775 18:77114853-77114875 CAGGGCGAGCAGTGGGCTGCAGG + Intronic
1160629856 18:80239210-80239232 CAGGGAGAAGAGGGGGTCGAAGG + Intronic
1160691809 19:463804-463826 CACAGTGAACGGGGGGCTGGCGG - Exonic
1160917936 19:1506646-1506668 CAGGGTGGGCAGGGGTCTGTGGG + Exonic
1160922184 19:1526225-1526247 GAGGGTGAACACGGCGCTGGTGG - Intronic
1161108217 19:2455117-2455139 CAGGGTGGGTAGGGGGCCGAGGG - Intronic
1162030288 19:7914324-7914346 CCGGGTGGGCAGGGGCCTGAGGG + Exonic
1163203203 19:15782822-15782844 GAGGGTGAACAGGGTGATGATGG + Intergenic
1163418506 19:17201399-17201421 CAGCGGGCACAGGGGGCCGATGG + Intronic
1163518044 19:17776595-17776617 CAGGGTGACAAGAAGGCTGAAGG + Intronic
1165424414 19:35738031-35738053 CAGGATGAACAGGGAACTCAGGG - Intronic
1165554300 19:36616901-36616923 CAGGGTGGACAGAGGGATGGAGG + Intronic
1166192335 19:41183310-41183332 CAGGATGAGCAGTGGGATGAGGG + Intergenic
1166230750 19:41424819-41424841 ACAGGTGAAGAGGGGGCTGACGG - Exonic
1166985718 19:46659276-46659298 CCGGGAGGACAGAGGGCTGAGGG + Intronic
1167015552 19:46838710-46838732 CCTGGTGAAGAGGAGGCTGAAGG - Intronic
1167418475 19:49389535-49389557 CAGGGTGCAAAGGGGGGCGATGG - Intronic
1168691910 19:58382385-58382407 GAGGGCGAGCAGGAGGCTGAAGG + Intergenic
925185625 2:1844249-1844271 CAGTGAGAACAGGGTGCTGCGGG - Intronic
925547267 2:5030424-5030446 AAAGGTGAACACGGGGCTCAGGG - Intergenic
927279154 2:21288478-21288500 CAGAGTGAACAAAGGGCTGTAGG + Intergenic
927648897 2:24899015-24899037 CAGGGTGACAAGGGGCATGAGGG - Intronic
927965176 2:27263645-27263667 CAGGGATAACAGTGGGTTGAAGG - Intronic
929792530 2:45034210-45034232 CAAGGTGAAGAGAGGGCTGCAGG + Intergenic
929928260 2:46232840-46232862 CAGGGTGAAATGGGGGTGGAGGG - Intergenic
930825480 2:55693169-55693191 CCTGGTGAAGAGGAGGCTGAAGG + Intronic
930860837 2:56071206-56071228 CAGGGCCAACAGGTGGCTGCTGG + Intergenic
931763449 2:65435618-65435640 CCGGCAGAACAGGGGGCTGCGGG + Intergenic
932051857 2:68405740-68405762 CTGGGTGAAGAGGTGGCTGTGGG + Intergenic
932231595 2:70088021-70088043 CAGGGTGACCGGGGGCCTGCTGG - Exonic
934717489 2:96552102-96552124 CGGGATGACCAGGGGGCTGAAGG - Exonic
934994951 2:98949395-98949417 AAGGATGAACAGGGAGCTGTAGG + Intergenic
936173489 2:110197492-110197514 CAGGGTGAGCAGGGGGCCCACGG + Intronic
936597107 2:113858570-113858592 CTGGGAGAACTGGGGGCTGAGGG - Intergenic
937248458 2:120509211-120509233 CTGGGTGAGCAGTGTGCTGATGG + Intergenic
938083143 2:128380882-128380904 CAGGATGAACTGGAGGGTGAGGG - Intergenic
938168843 2:129057228-129057250 CAGGGTGGACAGGGTGCTAAAGG - Intergenic
938201428 2:129376026-129376048 AAGGCTGAACACAGGGCTGAGGG - Intergenic
938392293 2:130915753-130915775 GAGGGTGAACAGGGGCCTGGGGG + Intronic
938938701 2:136149700-136149722 CAGTGTGAACAACTGGCTGAGGG + Intergenic
939084998 2:137708249-137708271 GAGGGAGCCCAGGGGGCTGAGGG - Intergenic
939116856 2:138070935-138070957 CAGGGGGAAGAGGTGGCTGTGGG - Intergenic
942541604 2:177020936-177020958 CAGTGTGAGCATGGGGGTGAGGG - Intergenic
942812233 2:180013051-180013073 ATGGATGAACAGGGGGCTGAGGG - Intergenic
943247374 2:185473145-185473167 GAGGGAGGCCAGGGGGCTGAGGG + Intergenic
944496662 2:200314007-200314029 CAGAATGAGCAGAGGGCTGAGGG - Intronic
944665340 2:201954680-201954702 CAGGGTGAACATGCTGCAGATGG + Intergenic
946178273 2:217935170-217935192 CAGGGTGAGGAGGGGGAGGAAGG + Intronic
946216466 2:218187571-218187593 AATGGTGACCAGGGGGCTGGAGG + Intergenic
946433041 2:219635650-219635672 CTGGGGGAACAAGGGGCTGCTGG - Intronic
947287534 2:228533154-228533176 CTGGGTGAACAGGGGCCTTGTGG + Intergenic
947344767 2:229179287-229179309 CTGGGTGGGCTGGGGGCTGATGG - Intronic
947372761 2:229465415-229465437 CAATGGGACCAGGGGGCTGAGGG + Intronic
948494316 2:238337029-238337051 CAGGGTGGAGAGGGGGCAGAGGG + Intronic
948676571 2:239600511-239600533 CAGAGTGGGAAGGGGGCTGAGGG + Intergenic
948748053 2:240110059-240110081 CAGGGTGCCCTGGGGGCTGGAGG + Intergenic
948771844 2:240255223-240255245 CAGGGTGAAGGGGGTGCTGGTGG - Intergenic
948867524 2:240783311-240783333 CAGGGTTTGCATGGGGCTGAGGG - Intronic
948953496 2:241270683-241270705 CGGGGTGGACATGGGGCTGTAGG - Intronic
1168810874 20:703788-703810 CAGTGTGAACAGGAAGTTGACGG + Intergenic
1169311093 20:4540706-4540728 CTGGGAGAACAGGGGCCTGGAGG - Intergenic
1169914662 20:10673471-10673493 CAGGGCGAGCAGGAGGCTTAGGG + Exonic
1170644253 20:18182656-18182678 CAGGGTGATCATGGAGCTGCAGG - Intronic
1170662665 20:18358243-18358265 GAGGATGAACAGGAGGATGAAGG + Intergenic
1171518287 20:25756954-25756976 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1171558570 20:26099252-26099274 CAGAGTGTAAAGGGGGCAGAAGG - Intergenic
1171973892 20:31581629-31581651 CAGGGTGCAAATGGGGCTGGGGG - Intergenic
1172136619 20:32690664-32690686 CAGCAGGAACAGGAGGCTGAAGG - Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1173167524 20:40696102-40696124 CAGGGAGAGGAGGGGGCTGGAGG - Intergenic
1174573911 20:51523782-51523804 CAGGGTGAACCTCGGGCTGGCGG + Exonic
1175206894 20:57317971-57317993 CAGGGGGCACAAGGGGCAGAAGG - Intergenic
1175638853 20:60609829-60609851 GAGGGTGAAGAGGGGGAAGAGGG + Intergenic
1175642483 20:60642670-60642692 CAGGCTGACCAAGGGGCTGTGGG - Intergenic
1175825400 20:61933991-61934013 CAGGGTGGAAGGGGGGCTGGCGG + Intronic
1175899451 20:62354301-62354323 CAGGCTGATCAGAGGCCTGAGGG - Intronic
1176652447 21:9563368-9563390 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1177259182 21:18706909-18706931 GAGGGTGAACAGGGGGAAGAGGG - Intergenic
1179167221 21:38944481-38944503 GAGGGTGGAGAGGGCGCTGATGG - Intergenic
1179718696 21:43303328-43303350 CGGGGTCAAGAGGGGGCTGACGG - Intergenic
1179984824 21:44914368-44914390 CAGGGGAAGCAGGGGGCTGAGGG + Intronic
1180083902 21:45498882-45498904 CAGGATGAACCTGGGGCTGAAGG + Intronic
1180612122 22:17104841-17104863 CTGGGAGAACAAGTGGCTGAAGG + Intronic
1180945156 22:19688618-19688640 CGGGGGGAAGAGGAGGCTGAGGG - Intergenic
1181007445 22:20020776-20020798 CAGGGTGAGCAGGTGACAGATGG + Intronic
1181511556 22:23391492-23391514 GAGGGTTAACTGAGGGCTGAGGG + Intergenic
1182115759 22:27755386-27755408 CAGGCAGCACAGGGGGCCGAGGG + Intronic
1182146162 22:27998110-27998132 CAGGGGTAACAAGGGGATGATGG - Intronic
1182485615 22:30636872-30636894 CAGGGTGAACAGAGGTGTGGTGG - Exonic
1183043151 22:35198381-35198403 CAGGGTGAAGAAGGGGGAGAGGG - Intergenic
1183319449 22:37156152-37156174 CAGAGGGAACAGGAGGCTGGAGG - Intronic
1183466263 22:37981859-37981881 CTGGGTGAGCAGGGCACTGAGGG + Intronic
1183600999 22:38840616-38840638 CAGTGTGGTTAGGGGGCTGATGG + Intronic
1184597536 22:45523281-45523303 AAGGGTAACCAGGTGGCTGAGGG + Intronic
1184849513 22:47112286-47112308 CTGGGTGAACACTGGGCAGAAGG - Intronic
1185103743 22:48855671-48855693 CAGGGTCCACTGTGGGCTGAGGG + Intergenic
1185205538 22:49535849-49535871 AAAGGTGGGCAGGGGGCTGAGGG + Intronic
1185337195 22:50275984-50276006 CAGGGTGGAAAAGGGGCTGTGGG + Intronic
950140973 3:10615069-10615091 CACAGAGAACAGGGGGCTGGTGG + Intronic
950427868 3:12934417-12934439 AAGAGAGAACAGGGGGCAGACGG + Intronic
950548218 3:13651656-13651678 CAGGCTGAACACAGGGCTGTAGG - Intergenic
950886583 3:16367734-16367756 CAGGTTGAAGAGTGGGGTGACGG + Intronic
950924646 3:16728416-16728438 GAGGGTGAAAAGGGGGCAGGCGG + Intergenic
952708597 3:36406142-36406164 CTGGGTGGGGAGGGGGCTGAGGG - Intronic
952905166 3:38135207-38135229 CGGGGTGAACAGGGTGATGGTGG - Intronic
953167031 3:40474638-40474660 GAGGAGGAACAGGGGGATGAGGG + Intergenic
953494742 3:43376326-43376348 CATGGAGAACAGTGGGCTGGGGG + Intronic
953726019 3:45399778-45399800 AAGGGTGGAAAGGGGGGTGAAGG - Intronic
954137670 3:48589546-48589568 CAGGGTGGAATGGGGGCTGGGGG - Intronic
954516723 3:51184778-51184800 CAATGTGGAAAGGGGGCTGAGGG + Intronic
955067612 3:55546361-55546383 CAGGGTTAATAGGGTGCTCAAGG - Intronic
957785323 3:84875039-84875061 CAGCGTGAACAGAGGGCCTATGG - Intergenic
958533632 3:95366940-95366962 CACGGGGGACAGGGGGCGGAGGG - Intergenic
960732699 3:120743822-120743844 CAGGGTAGACAGAGGGCAGAGGG + Intronic
961381539 3:126499083-126499105 CAGTGAGAACAGGGGGCTGCGGG - Intronic
962074967 3:132072017-132072039 AAGGATGAAGACGGGGCTGATGG - Intronic
962373742 3:134842416-134842438 CTGGATGAACAGGGCTCTGATGG - Intronic
962954344 3:140250355-140250377 CATGGTGAAATGGGGGCAGATGG + Intronic
963751149 3:149181179-149181201 CAGGGAGAGCAGGGGCCAGATGG - Intronic
964116283 3:153139526-153139548 CAGGGTGGACTGAGGACTGAAGG - Intergenic
965017582 3:163177705-163177727 CAGGGTGGAGAGTGGGATGAGGG + Intergenic
965984528 3:174735921-174735943 AAGGGTGAACAGAGTGGTGAGGG + Intronic
967596458 3:191330338-191330360 CGAGGGGAACAGGGGACTGATGG + Intronic
967994847 3:195158717-195158739 CAGGCTGCACAGGGGCCTGTTGG - Intronic
968591414 4:1461514-1461536 GAGGGTGAACAGGGAACAGAGGG + Intergenic
968616279 4:1579161-1579183 CAGGGGGGGCAGGGGCCTGACGG - Intergenic
968782779 4:2595607-2595629 CAAGATAAACAGGGAGCTGATGG - Intronic
969331340 4:6474827-6474849 GGGGGTGGGCAGGGGGCTGAGGG - Intronic
969571753 4:8012901-8012923 AAGGGTGAACAGAGGGTAGATGG - Intronic
969727291 4:8928238-8928260 CTGGGTGATCAGGGGCCTCATGG + Intergenic
969915940 4:10491913-10491935 GAGGGTGAGAAGGGGGCTAAGGG - Intronic
970419142 4:15888715-15888737 CAGGCTGTACAGGAAGCTGATGG - Intergenic
972075225 4:35079087-35079109 CAGGGAGGCCAGGGGACTGAGGG + Intergenic
976834247 4:89352290-89352312 AAGGGTGATTAGGGGGGTGAAGG - Intergenic
977219824 4:94325718-94325740 CAGGAAGCACAGGGGGTTGAGGG - Intronic
977764877 4:100785327-100785349 CTGGGTGAACAGGGGCAGGAGGG + Intronic
978342009 4:107728923-107728945 CAGGGTGAACAGGATGATGGTGG + Intergenic
978437227 4:108698655-108698677 GAGGGTGGAAAGAGGGCTGAGGG - Intergenic
978453540 4:108863368-108863390 CAGGGTGAACGGGGGGAAGCAGG - Exonic
979733397 4:124052491-124052513 AAGGCTGATCAAGGGGCTGAGGG + Intergenic
980270088 4:130573387-130573409 CTGGGTGACCAGGGGACTCATGG - Intergenic
980520846 4:133932014-133932036 CAGGGTAAACCAGGGGCTGTGGG - Intergenic
980638308 4:135538783-135538805 CAGGGTGAACAGGGTGATGGTGG - Intergenic
985548573 5:522005-522027 CAGAGTGCACAGTGGGTTGAGGG + Intronic
985702705 5:1383243-1383265 GAGGGTGAGCAGGGGGTTGGGGG - Intergenic
985763060 5:1761518-1761540 CAGGGTGCACAGGAGGCTTTGGG - Intergenic
985876925 5:2606985-2607007 CAGATGGAGCAGGGGGCTGAAGG - Intergenic
986271254 5:6232904-6232926 CAGGGAGAAGATGGGGCTGGAGG + Intergenic
986703913 5:10439826-10439848 CAGGGTGAACACAGAGGTGATGG - Exonic
988796708 5:34657865-34657887 CAGGGCGAACAGGGACCTGCAGG - Intronic
992163869 5:74029222-74029244 CAGATTGTTCAGGGGGCTGAAGG + Intergenic
995495681 5:112739607-112739629 CAAGCTAAACAGGAGGCTGAGGG + Intronic
997665319 5:135625718-135625740 CAGGTAGAACAGGGGGAAGAAGG + Intergenic
997746213 5:136302378-136302400 AAGGGTGAAGAAGGGGTTGAGGG - Intronic
998874523 5:146586026-146586048 CAGGGGGAAGAGGTGGATGAAGG + Intronic
1000379988 5:160620471-160620493 CAGGGTGCAGAGGAGGCTGAAGG + Exonic
1000941948 5:167372428-167372450 CAGAGGTAACAGTGGGCTGAGGG - Intronic
1001182106 5:169530096-169530118 CAGGGAGAACATGAGGCTGTTGG - Intergenic
1001673637 5:173494483-173494505 CAGAGTTAACAGGGTGCTAATGG - Intergenic
1002274291 5:178094390-178094412 CATGGTAAAGAGGGGGCTGCGGG + Intergenic
1002374400 5:178777909-178777931 CAGGGGGAACAGGTGACTGCCGG + Intergenic
1002440624 5:179262563-179262585 CAGCGTGACCAAGGGGCAGAAGG - Intronic
1002478978 5:179486825-179486847 CACGGTGAAGAGGGGGCGGCAGG - Intergenic
1002563491 5:180097747-180097769 CAGGGGACACAGGGGGCTCAGGG + Intergenic
1003542608 6:7031768-7031790 TAGGGTGAGCACTGGGCTGATGG - Intergenic
1004014211 6:11717721-11717743 CAGGGAGGACAGGGAACTGAGGG + Intronic
1004156273 6:13171096-13171118 CAGGGAGAACAGGTGGCTGGTGG - Intronic
1005869372 6:29962813-29962835 CAGGGAGATCAGGGGGCAAAAGG + Intergenic
1006002509 6:30976417-30976439 CAGGGAGGAGAGGGGACTGAAGG - Intergenic
1006358758 6:33575847-33575869 CAGCAGGAACAGGAGGCTGAAGG - Exonic
1006431623 6:34000687-34000709 GAGGGAGCACAGGGGGCTGAGGG + Intergenic
1007991658 6:46262331-46262353 CAGGGTGAACAGGGGGCTGATGG - Intronic
1014792257 6:125686749-125686771 CAGGGGGAAGAGGGAGGTGAGGG - Intergenic
1015547143 6:134372799-134372821 CAGGGTAAAAAGTGGGCTGATGG + Intergenic
1017254902 6:152322877-152322899 AAGTGTGAAAAGGGAGCTGAGGG - Intronic
1017657725 6:156645905-156645927 AATGGAGCACAGGGGGCTGAAGG + Intergenic
1018425334 6:163674882-163674904 CAGAGTGAAGAGGGGGAAGATGG + Intergenic
1019660833 7:2223204-2223226 CAGCGTGGACAGGAGGCTGTGGG + Intronic
1019665988 7:2252617-2252639 CAGGGTGAAGGGGGGGCTGGAGG - Exonic
1019925927 7:4191745-4191767 CAGGGTGGACAGGGGGCTGCAGG + Intronic
1019935143 7:4249982-4250004 CAGGGTGTTTTGGGGGCTGATGG - Intronic
1019952837 7:4387729-4387751 CAGATTGAACAGAGGGCTAAAGG + Intergenic
1020374973 7:7474650-7474672 CAGGGTGAAAAAGGTTCTGAAGG - Exonic
1022517720 7:30986691-30986713 CAGGATGAGAAGGGGACTGAGGG + Intronic
1022528238 7:31052069-31052091 CGGGGATGACAGGGGGCTGAGGG + Intergenic
1023704947 7:42931876-42931898 CGGGGTTAACATGGGGCTGCGGG - Intronic
1025279114 7:57614295-57614317 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1025305617 7:57851205-57851227 CAGAGTGTAAAGGGGGCAGAAGG - Intergenic
1026353089 7:69534537-69534559 CCGGCTGAGCAGGGTGCTGAAGG + Intergenic
1026955874 7:74376210-74376232 CAGCGAGAACATGGGGCTAATGG + Exonic
1026998600 7:74635947-74635969 CAAGGTGCACAGGGTGCAGAGGG - Intergenic
1027239374 7:76317515-76317537 AAGGGCGCACAGGAGGCTGATGG + Intergenic
1027682030 7:81233366-81233388 GAGGGAGGCCAGGGGGCTGAGGG - Intergenic
1028959768 7:96735574-96735596 CAGGATGAACAGGTAGATGATGG - Intergenic
1029245494 7:99196667-99196689 CAGGGTTACCATGGAGCTGAGGG - Intronic
1030281508 7:107780523-107780545 CAGGGGGAACAGGACGGTGAGGG - Intronic
1031350713 7:120727749-120727771 CAGGGTGAAAAAGGAGCAGAAGG + Intronic
1031422660 7:121568697-121568719 AAGGGTGAAGAAGGGGTTGAGGG + Intergenic
1031917740 7:127578914-127578936 CTGGGGGAAAAGGGGGATGAGGG + Intergenic
1033242245 7:139689990-139690012 CGGTGTGCACAGGGGGCTGGGGG + Intronic
1033595106 7:142853985-142854007 CAGGGAGAAAAGGGGGCAAAGGG + Intergenic
1033630080 7:143148958-143148980 CAGAGTGAACAGAGGGGTGCAGG - Intergenic
1034412030 7:150946898-150946920 GAGGGTGGGGAGGGGGCTGACGG + Exonic
1034413503 7:150953414-150953436 CTGTGTGGAGAGGGGGCTGAGGG - Intronic
1035136084 7:156704053-156704075 CTGGGTTACAAGGGGGCTGAGGG + Intronic
1035172160 7:157022799-157022821 CAGGGTGGACCAGGGGCTGCTGG - Intergenic
1035527405 8:324616-324638 GTGGGTGAACAGGGGGTGGAGGG + Intergenic
1037764905 8:21766661-21766683 GAGGATGAACAGGGGCCTGGGGG + Intronic
1037765180 8:21768407-21768429 GCGGGGGCACAGGGGGCTGAGGG - Intronic
1038227564 8:25670888-25670910 TGGGGAGATCAGGGGGCTGAGGG - Intergenic
1038482235 8:27909707-27909729 AAAGGTGATCAGGGGGATGAAGG - Exonic
1039598092 8:38809068-38809090 CAGGCTGGGCAGAGGGCTGAAGG - Intronic
1040548715 8:48422264-48422286 CAGGGAGAACAGGGCGCTGTAGG + Intergenic
1040672124 8:49704424-49704446 CAGGGTGACCTGGGGGATGGTGG - Intergenic
1040969248 8:53115600-53115622 CTGGGTGGACAGTGGGCTGGGGG - Intergenic
1041076282 8:54173041-54173063 AAGGATGACCATGGGGCTGACGG - Intergenic
1043677338 8:82973777-82973799 CTGGGTGACCAGGGGCCTCATGG - Intergenic
1044335894 8:90984937-90984959 CAGGGTCCACAGGGTACTGAAGG + Intronic
1044416866 8:91948972-91948994 CAGGGTGAAGAAGGGGTTGAGGG - Intergenic
1045220714 8:100197208-100197230 CAGGGAGCTCAGGAGGCTGAGGG + Intronic
1046101346 8:109617328-109617350 AAGGGGGAACAGAGTGCTGATGG + Intronic
1048163692 8:132043286-132043308 CAGGGTTAACAGGAGGCCTATGG - Intronic
1048616549 8:136081228-136081250 CAGGGAGCTCAGGGAGCTGAAGG - Intergenic
1049381835 8:142320058-142320080 CAGGGTGAGGAGGGGACTGGTGG - Intronic
1049471253 8:142775937-142775959 CAGGGTGAGCAGGGGCGTCATGG + Exonic
1049600603 8:143505689-143505711 CAGGATGCACATGTGGCTGAGGG - Intronic
1050062721 9:1727291-1727313 CAGGGTGCACAATGGGCTCAAGG + Intergenic
1050921753 9:11212436-11212458 CAAGGGAAATAGGGGGCTGAAGG + Intergenic
1051345786 9:16149845-16149867 TGGGGTGAATAGGGGGGTGAAGG - Intergenic
1051427682 9:16950289-16950311 CAGGGAGAGGATGGGGCTGAAGG + Intergenic
1053055773 9:34992293-34992315 CAGGGTGGACTGGGGGCGTAGGG + Intronic
1053307729 9:36995864-36995886 CAGGGAGCACAGGGGGGTGGAGG - Intronic
1053477943 9:38395696-38395718 CAGGGTGAACAGGTGGGAGAAGG - Intronic
1054260715 9:62862668-62862690 CAGGGTGAAGAGTGGGCAGCAGG - Intergenic
1055712403 9:79077445-79077467 CAGGAAGAACACTGGGCTGAGGG - Intergenic
1056628411 9:88273170-88273192 CAGGGTGACCAGGAGGCCGTCGG + Intergenic
1057305150 9:93907948-93907970 GAGGGTGAACAGCTGGCTGGAGG - Intergenic
1060106979 9:120878659-120878681 CAGGGGGATCAAGGGGCAGAAGG - Intronic
1060462905 9:123875556-123875578 CAGGATGGAGAGGGGGCTGTGGG - Intronic
1061054879 9:128217185-128217207 CTCGGTTCACAGGGGGCTGAAGG + Intronic
1061499716 9:130994852-130994874 CAGGATGGAGAGGGAGCTGATGG - Intergenic
1062079952 9:134618571-134618593 CAGGGTGGACATGAGGCTGCGGG + Intergenic
1062389283 9:136327625-136327647 CAGGGCGGGCAGGGGGCGGACGG + Exonic
1062425965 9:136506403-136506425 CAGGGTGAGGAGGAGGATGAAGG + Intronic
1203630176 Un_KI270750v1:66909-66931 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1185478878 X:431274-431296 CAGGGTGAGAAGGTGGCTGTCGG + Intergenic
1185612639 X:1401782-1401804 GAGGGTGAACTGAGGTCTGAGGG + Intergenic
1185634164 X:1539081-1539103 CACTGTGACCAGGGGCCTGAAGG - Intergenic
1186293331 X:8122403-8122425 CAGCGTGGAAAGGGAGCTGAGGG - Intergenic
1186732609 X:12426356-12426378 CAGGGCTAAGAGGGGCCTGAGGG + Intronic
1190082925 X:47370971-47370993 CAGGGTTAAGAGGGGAGTGATGG - Intronic
1190305675 X:49080163-49080185 GTGGGTGACCAAGGGGCTGAGGG - Intronic
1190338513 X:49278063-49278085 AAGGGTGCTCTGGGGGCTGAAGG + Intronic
1192639261 X:72847039-72847061 TTGAGGGAACAGGGGGCTGAAGG + Intronic
1192642450 X:72873766-72873788 TTGAGGGAACAGGGGGCTGAAGG - Intronic
1192999570 X:76550039-76550061 CTGGGGGAACGGGAGGCTGAGGG - Intergenic
1193174806 X:78380163-78380185 CAGGGGAAGAAGGGGGCTGAAGG - Intergenic
1195327447 X:103769177-103769199 CATGGTGGGCAGGAGGCTGATGG + Intergenic
1195756370 X:108202962-108202984 CAGGGTGAACCAGGGCCTAAGGG - Exonic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1200825875 Y:7639999-7640021 GAGGGTGAATAAGGGACTGATGG + Intergenic
1202369245 Y:24186093-24186115 CAGGGTACACAGGGGTCTGAGGG + Intergenic
1202501540 Y:25484024-25484046 CAGGGTACACAGGGGTCTGAGGG - Intergenic