ID: 1007993559

View in Genome Browser
Species Human (GRCh38)
Location 6:46282646-46282668
Sequence CCACTGATCTAGAGCTTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007993555_1007993559 -5 Left 1007993555 6:46282628-46282650 CCAAAGCCTGTTTTTGGACCACT 0: 1
1: 0
2: 0
3: 16
4: 149
Right 1007993559 6:46282646-46282668 CCACTGATCTAGAGCTTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007993559 Original CRISPR CCACTGATCTAGAGCTTAGG AGG Intronic
No off target data available for this crispr